Detection of Non-Coding RNA (Hsa_circ_0003416) in Pulmonary

Arterial Hypertension Patients’ Plasma by qRT-PCR Analysis

Fajri Marindra Siregar

1,2 a

, Dicka Wahyu Setiasari

, Anggoro Budi Hartopo

4,* c

Lucia Kris Dinarti

and Sofia Mubarika Haryana

Doctorate Program, Faculty of Medicine, Public Health and Nursing, Gadjah Mada University, Yogyakarta, Indonesia

Department of Biochemistry, Faculty of Medicine, Universitas Riau, Pekanbaru, Indonesia

Faculty of Medicine, Public Health and Nursing, Gadjah Mada University, Yogyakarta, Indonesia

Department of Cardiology and Vascular Medicine, Faculty.of Medicine, Public Health and Nursing,

Universitas Gadjah Mada–Dr. Sardjito Hospital, Yogyakarta, Indonesia

Department of Histology and Cell Biology, Faculty of Medicine, Public Health and Nursing,

Gadjah Mada University, Yogyakarta, Indonesia

Keywords: Circular RNA, hsa_circ_0003416, Pulmonary Arterial Hypertension, Non-Coding RNA, qRT-PCR.

Abstract: Circular RNA refers to a type of non-coding RNA molecule and possesses a circular conformation. Circular

RNA has greater stability compared to linear RNA due to its resistance to RNAse activity. hsa_circ_0003416

is a circular RNA reported to have potential as a biomarker in patients with pulmonary arterial hypertension

(PAH). This study aims to detect hsa_circ_0003416 using qRT-PCR in the plasma of PAH patients. The

sample was taken from RSUP Dr. Sardjito Yogyakarta. The miRNeasy Serum/Plasma Advanced kit was

used to isolate total RNA. Following that, cDNA was generated with an Applied Biosystems thermal cycler

and the ExcelRT

Reverse Transcription Kit II reagent, and qPCR was performed with an Applied

Biosystems

7500 Real-Time PCR equipment and the SensiFAST

SYBR® Lo-ROX Kit reagent.

Specific divergent primers were utilized. Melting curve analysis and visualization of the amplified products

were performed using gel electrophoresis. The qRT-PCR technique achieved a single amplification, resulting

in a melting curve value observed at 81.8

C. Examination by visualizing the gel electrophoresis results

showed a single band that matched the target size, specifically 124 base pairs. In conclusion, the qRT-PCR

analysis successfully identified the presence of hsa_circ_0003416 in the plasma of PAH patients.

1 INTRODUCTION

Circular RNA or circRNA is a unique form of RNA

molecule that does not code for proteins (non-coding

RNA) (Greene et al., 2017). It is conserved across

different species and exhibits a strong preference for

specific tissues and cells (Z. Yu et al., 2021).

Additionally, circRNA can be identified in the

peripheral blood (Wen et al., 2021). Circular RNA

has enhanced stability compared to other RNA types

due to its closed-loop structure, resulting in an

extended half-life (Sharma et al., 2021). The

attributes above make circRNA a promising

https://orcid.org/0000-0002-1239-7338

https://orcid.org/0009-0007-4646-5216

https://orcid.org/0000-0002-6373-1033

https://orcid.org/0000-0002-4011-2184

https://orcid.org/0000-0001-7205-652X

candidate for future use as noninvasive and liquid

biopsy biomarkers.

Circular RNAs can modulate gene expression

both during and after transcription by interacting with

microRNAs (miRNAs) or RNA-binding proteins

(C.-Y. Yu & Kuo, 2019). They play a part in a diverse

array of biological processes. Newly available data

uncovers complex connections between several

forms of RNA, including protein-coding messenger

RNAs and non-coding RNAs (Sharma et al., 2021).

The presence of this circRNA-miRNA-mRNA

regulatory pathway is associated with the

pathogenesis of numerous diseases, including

Siregar, F. M., Setiasari, D. W., Hartopo, A. B., Dinarti, L. K. and Haryana, S. M.

Detection of Non-Coding RNA (Hsa_circ_0003416) in Pulmonary Arterial Hypertension Patients’ Plasma by qRT-PCR Analysis.

DOI: 10.5220/0013672000003873

Paper published under CC license (CC BY-NC-ND 4.0)

In Proceedings of the 1st International Conference on Medical Science and Health (ICOMESH 2023), pages 335-339

ISBN: 978-989-758-740-5

335

pulmonary arterial hypertension (PAH). (Tang et al.,

2021; Wu et al., 2022).

Dysregulated circRNA expression may lead to

the development of PAH. A study found that

hsa_circ_0003416 was markedly reduced in children

with PAH associated with congenital heart diseases

(CHD) and has potential as a biomarker (Huang et al.,

2022). An in-silico study has discovered that

hsa_circ_0003416 is a circRNA molecule that is 124

base pairs in length. It originates from exon three of

the thymosin beta 4 X-linked gene (TMSB4X)

(Huang et al., 2022). It plays a crucial function in

regulating the process of angiogenesis (Huang et al.,

2022). There is a scarcity of studies on the expression

of hsa_circ_0003416 in PAH associated with CHD.

Furthermore, the utilization of qRT-PCR for the

analysis of circular RNA remains unfamiliar,

particularly in Indonesia. This study aims to detect

hsa_circ_0003416 using qRT-PCR approaches from

the plasma of PAH patients.

2 MATERIALS AND METHODS

The study was conducted in the Integrated Research

Laboratory of the Faculty of Medicine, Public

Health, and Nursing at Universitas Gadjah Mada

(UGM). The specimens utilized were plasma samples

obtained from patients diagnosed with PAH

associated with CHD, who had an examination at

RSUP Dr. Sardjito Yogyakarta and were

subsequently enrolled in the Congenital HeARt

Disease in adult and Pulmonary Hypertension

(COHARD-PH) registry (Dinarti et al., 2020).

Medical And Health Research Ethics Committee

(MHREC) Faculty of Medicine, Public Health and

Nursing UGM approved this study. (number

KE/FK/0429/EC/2023)

2.1 RNA Isolation

The RNA isolation process utilised the miRNeasy

Serum/Plasma Advanced kit from Qiagen [217204].

The sample volume utilized was 200 µl. Next, the

isolation technique is executed in accordance with

the manufacturer's protocol. The isolation results

were further analyzed using a nanodrop to ascertain

the concentration and purity of RNA.

2.2 Synthesis of cDNA

The cDNA synthesis was performed using the

ExcelRT™ Reverse Transcription Kit II from

Smobio [RP1400], following the manufacturer's

instructions. The RNA templates utilized were 50 ng.

The cDNA synthesis method was conducted using an

Applied Biosystems thermal cycler, the protocol is as

follows: incubation step at 25

C (10 minutes),

reverse-transcription step at 42

C (50 minutes), and

inactivation of reaction 85

C (5 minutes).

2.3 qPCR hsa_circ_0003416

The SensiFAST™ SYBR® Lo-ROX Kit [BIO-

94005] was employed in accordance with the

manufacturer's instructions, utilising the Applied

Biosystems™ 7500 Real-Time PCR instrument. The

cDNA product was diluted in a ratio of 1:5 before

being used as a template. The primers used are

Forward divergent

CCCCTTTCACACATCAAAGAAC and Reverse

divergent ATTTAAACTTGATCCAACATGC

(Huang et al., 2022). The primer concentration used

was 400nM with a total reaction volume of 20 µl. The

qPCR protocol is as follows: polymerase activation at

C (2 minutes), 40 cycles of denaturation step at

C (5 seconds), and annealing/extension step at

C (30 seconds). The amplicons were subjected to

melting curve analysis and visualization using gel

electrophoresis when they were completed.

3 RESULTS

A study was done using the protocol described in the

methods section. The findings from the

hsa_circ_0003416 analysis presented in Figure 1.

According to the qRT-PCR technique employed, a

single amplification was achieved, resulting in a

melting curve value observed at a temperature of

81.8

Subsequently, gel electrophoresis was conducted

to verify the amplification product. The visualization

results with gel electrophoresis are shown in Figure

2. There is a visible band within the sample that is

about 124 base pairs in length.

4 DISCUSSIONS

A qRT-PCR study was performed to amplify the

hsa_circ_0003416 target in the plasma of patients

diagnosed with PAH associated with CHD at Dr.

RSUP. Sardjito Yogyakarta. Circular RNA is a

circular-shaped non-coding RNA. Unlike linear

RNA, the analysis of circRNA requires the utilization

of random primers during the cDNA synthesis step

(Panda

et al., 2017). The subsequent phase involves

ICOMESH 2023 - INTERNATIONAL CONFERENCE ON MEDICAL SCIENCE AND HEALTH

336

Figure 1: qPCR amplification (top) and melting curves

(bottom) of hsa_circ_0003416.

Figure 2: Visualization with 2% gel electrophoresis.

the utilization of a unique primer known as a

divergent primer. Divergent primers are designed to

amplify a specific portion of circRNA, known as the

backsplice junction, by working in the opposite

manner as shown in Figure 3 (Dieterich &

Papantonis, 2018). Amplification will take place if

the cDNA template utilized includes the desired

circRNA.

The approach we employ, while able to identify

the target circRNA, has limitations, specifically that

the target circRNA is detected at a relatively high

cycle threshold value (CT Value) of approximately

32. These results suggest a low abundance of

circRNA targets in the cDNA template. Therefore,

additional steps, such as the circRNA purification

procedure, must be considered. The RNase R

treatment might enhance the presence of circular

RNAs in an RNA sample. This strategy can

effectively eliminate linear RNAs (Xiao & Wilusz,

2019).

A single peak in the melting curve analysis

signifies the existence of a distinct qPCR product.

Subsequently, the qPCR product can be observed by

gel electrophoresis. Essentially, the amplicons

generated by qPCR will migrate across the medium

and come to a halt at a specific location based on their

size. A band will be formed at the location where

these amplicons accumulate, which will be visible

(Rana & Joshi, 2023). Thus, the size of the amplicon

generated by the qPCR reaction can be determined

using gel electrophoresis. The investigation revealed

that the length of hsa_circ_0003416 was 124 base

pairs. The acquired gel electrophoresis results

showed a solitary band within the 100-150 bp range,

confirming the findings. Nevertheless, a sequencing

analysis is required to validate this result (Dieterich

& Papantonis, 2018).

This study aims to verify the qRT-PCR method

for assessing the expression of the hsa_circ_0003416

gene in patients with PAH at RSUP Dr. Sardjito

Yogyakarta. It is a preliminary research report.

Subsequently, all research samples will undergo

examination in order to acquire expression patterns.

Patients with PAH may have an aberrant regulation

of hsa_circ_0003416 expression, which could play a

role in the development of the disease.

Detection of Non-Coding RNA (Hsa_circ_0003416) in Pulmonary Arterial Hypertension Patients’ Plasma by qRT-PCR Analysis

337

Figure 3: The linear RNA that is made by linear splicing is shown on the left, and the circRNA that is made by back splicing

is shown on the right. These two types of primaries (convergent and divergent) work in different directions

5 CONCLUSIONS

The qRT-PCR approach, as described in the protocol,

is capable of detecting hsa_circ_0003416 in the

plasma of patients diagnosed with PAH associated

with CHD at RSUP Dr. Sardjito Yogyakarta.

Additional research, utilizing a sufficient number of

samples, is required to ascertain the expression

pattern of hsa_circ_0003416.

ACKNOWLEDGEMENTS

This work was supported by Hibah Penelitian Dana

Masyarakat (Damas) FKKMK UGM 2023. We also

thank the PAH team from FKKMK UGM and RSUP

Dr. Sardjito Yogyakarta for their invaluable support

in supplying the samples.

REFERENCES

Dieterich, C., & Papantonis, A. (2018). Circular RNAs

methods and protocols. Methods in Molecular Biology,

1724. https://doi.org/10.1007/978-1-4939-7562-4

Dinarti, L. K., Hartopo, A. B., Kusuma, A. D., Satwiko, M.

G., Hadwiono, M. R., Pradana, A. D., & Anggrahini,

D. W. (2020). The COngenital HeARt Disease in adult

and Pulmonary Hypertension (COHARD-PH) registry:

a descriptive study from single-center hospital registry

of adult congenital heart disease and pulmonary

hypertension in Indonesia. BMC Cardiovascular

Disorders, 20(1), 163. https://doi.org/10.1186/s12872-

020-01434-z

Greene, J., Baird, A.-M., Brady, L., Lim, M., Gray, S. G.,

McDermott, R., & Finn, S. P. (2017). Circular RNAs:

biogenesis, function and role in human diseases.

Frontiers in Molecular Biosciences, 4, 38.

https://doi.org/10.3389/fmolb.2017.00038

Huang, Y., Su, D., Ye, B., Huang, Y., Qin, S., Chen, C.,

Zhao, Y., & Pang, Y. (2022). Expression and clinical

significance of circular RNA hsa_circ_0003416 in

pediatric pulmonary arterial hypertension associated

with congenital heart disease. Journal of Clinical

Laboratory Analysis, 36(4), e24273.

https://doi.org/10.1002/jcla.24273

Panda, A. C., Abdelmohsen, K., & Gorospe, M. (2017).

RT-qPCR detection of senescence-associated circular

RNAs. Methods in Molecular Biology, 1534, 79–87.

https://doi.org/10.1007/978-1-4939-6670-7_7

Rana, B., & Joshi, G. K. (2023). Electrophoresis: Basic

principle, types, and applications. In Basic

biotechniques for bioprocess and bioentrepreneurship

(pp. 183–193). Academic Press.

https://doi.org/10.1016/B978-0-12-816109-8.00011-8

Sharma, A. R., Bhattacharya, M., Bhakta, S., Saha, A., Lee,

S.-S., & Chakraborty, C. (2021). Recent research

progress on circular RNAs: Biogenesis, properties,

functions, and therapeutic potential. Molecular

Therapy Nucleic Acids, 25, 355–371.

https://doi.org/10.1016/j.omtn.2021.05.022

Tang, Y., Bao, J., Hu, J., Liu, L., & Xu, D.-Y. (2021).

Circular RNA in cardiovascular disease: Expression,

mechanisms and clinical prospects. Journal of Cellular

and Molecular Medicine, 25(4), 1817–1824.

https://doi.org/10.1111/jcmm.16203

Wen, G., Zhou, T., & Gu, W. (2021). The potential of using

blood circular RNA as liquid biopsy biomarker for

ICOMESH 2023 - INTERNATIONAL CONFERENCE ON MEDICAL SCIENCE AND HEALTH

338

human diseases. Protein & Cell, 12(12), 911–946.

https://doi.org/10.1007/s13238-020-00799-3

Wu, M., Xun, M., & Chen, Y. (2022). Circular RNAs:

regulators of vascular smooth muscle cells in

cardiovascular diseases. Journal of Molecular

Medicine. https://doi.org/10.1007/s00109-022-02186-

Xiao, M.-S., & Wilusz, J. E. (2019). An improved method

for circular RNA purification using RNase R that

efficiently removes linear RNAs containing G-

quadruplexes or structured 3’ ends. Nucleic Acids

Research, 47(16), 8755–8769.

https://doi.org/10.1093/nar/gkz576

Yu, C.-Y., & Kuo, H.-C. (2019). The emerging roles and

functions of circular RNAs and their generation.

Journal of Biomedical Science, 26(1), 29.

https://doi.org/10.1186/s12929-019-0523-z

Yu, Z., Huang, Q., Zhang, Q., Wu, H., & Zhong, Z. (2021).

CircRNAs open a new era in the study of

cardiovascular disease (Review). International Journal

of Molecular Medicine, 47(1), 49–64.

https://doi.org/10.3892/ijmm.2020.4792

Detection of Non-Coding RNA (Hsa_circ_0003416) in Pulmonary Arterial Hypertension Patients’ Plasma by qRT-PCR Analysis

339