Novel Primers for Easy Detection of Yellow Fever Using Isothermal

PCR

Naufal Dimas Lingga Takbirrahman, Dea Syafira Alamsyah Sitompul

, Nicholas Gabriel Harefa

and Arief Budi Witarto

Department of Biology Cell and Molecular, Faculty of Military Medicine, The Republic of Indonesia Defense University,

IPSC Sentul, Bogor, 16810, Indonesia

Keywords: Yellow Fever Virus, Isothermal PCR, NS2a, NS5

Abstract: Yellow Fever is a disease caused by the Yellow Fever Virus (YFV), common in tropical areas in Africa and

South America. Hundreds of Indonesian soldiers are sent on peacekeeping missions to Congo -an endemic

region for YFV- every year. Therefore, an accurate technique is needed to screen those who possibly get

infections. Isothermal PCR, unlike conventional PCR, uses a single temperature with 4 to 6 combinations of

primers that can be performed with simple equipment such as a heat block and detected with a visual eye

instead of agarose electrophoresis. Thus, it is suitable for this challenge. YFV strain 17D genome was used

and particularly NS2a and NS5 genes were chosen as template for the design of primers. To check for

specificity, obtained primers were checked for sequence similarity using BLASTN. Literature studies showed

that various genes, including E and NS5, have been used for the target using conventional PCR. Meanwhile,

for isothermal PCR, only the NS1 gene and upstream non-coding gene have been used. From the NS2a gene

with length of 672 bp, 2 sets of primers were obtained. At the same time, NS5, with a longer length of 2,714

bp, gave 4 sets of primers. BLASTN results showed that all primers were specific to the YFV genome.

Original primers have been successfully designed for isothermal PCR of yellow fever. Primers designed are

the first step and also the most critical original works in nucleic acid testing. Therefore, towards self-sufficient

diagnostic reagents, the results are significant.

1 INTRODUCTION

1.1 Yellow Fever Virus

Yellow Fever is a disease caused by the Yellow Fever

Virus (YFV), which is common in tropical areas in

Africa and South America. The disease primarily

affects humans and nonhuman primates and is

transmitted through the bite of an infected mosquito.

Forty-seven countries in Africa, Central and South

America are either endemic for Yellow Fever Virus

(YFV) or have endemic areas. A modelling study

based on African data sources estimated the incidence

of Yellow Fever during 2013 was 84,000-170,000

severe cases and 29,000-60,000 deaths (Gardner et al,

2010).

Every year, hundreds of Indonesian soldiers are

sent on a peacekeeping mission to Congo - an

endemic region for YFV - who trained before

departure and returned home first to IPSC, where The

Republic of Indonesia Defense University is located.

Therefore, screening for possible YFV infection

among returning soldiers with an easy yet accurate

technique is necessary. Isothermal PCR, unlike

conventional PCR, uses single temperature and with

4 to 6 combinations of primers can be performed with

simple equipment such as a heat block, and can be

detected with a visual eye instead of using agarose

electrophoresis. Thus, it is suitable for this challenge

(Gardner et al, 2010).

1.2 Yellow Fever Virus Complete

Genome

Yellow Fever Virus is a single-stranded RNA virus

consisting of 10 constituent genes, namely 3

structural genes (C, prM, and E) and 7 nonstructural

genes (NS1, NS2a, NS2b, NS3, NS4a, NS4b, and

NS5). A third of the YFV genome is encoded by 3

structural proteins, while two-thirds comprises 7

nonstructural proteins. One of the most targeted

Takbirrahman, N. D. L., Sitompul, D. S. A., Harefa, N. G. and Witarto, A. B.

Novel Primers for Easy Detection of Yellow Fever Using Isothermal PCR.

DOI: 10.5220/0013671600003873

Paper published under CC license (CC BY-NC-ND 4.0)

In Proceedings of the 1st International Conference on Medical Science and Health (ICOMESH 2023), pages 299-302

ISBN: 978-989-758-740-5

299

genomes for many researchers is Yellow Fever Virus-

17D, which is also very effective as a vaccine to form

antibodies against YFV itself. The genome was seen

as the most similar to the original YFV genome, so

that genome is used as the target sequence for this

test. Although further research is still needed on it,

and we must keep up to date with the latest

information about the virus (Nunes et al, 2015).

Among the 10 genes in the entire YFV genome,

NS2a is a small hydrophobic protein, one of the

nonstructural proteins of YFV and plays a role in its

virulence factors. Because this gene is essential for

the virus, we made it one of the target genes in the test

that we carried out. In addition, NS5 is another

protein in the YFV genome that has been the target of

molecular screening research that can be used as a

primer for PCR tests. It is undoubtedly in line with

our test's purpose, and is why NS5 is also one of the

target genes in this paper (Voßmann et al, 2015 and

Rezende et al, 2019).

1.3 Advantages of The LAMP Method

The LAMP (Loop-mediated isothermal amplification

of DNA) method was designed in 1998 by a Japanese

company. This technique increases the amount of

DNA amplified to one billion copies in less than an

hour and is very specific. Isothermal amplification

can be performed without sophisticated laboratory

equipment. Another innovative aspect of LAMP is its

high specificity due to the use of multiple primers

(from four to six), which can distinguish up to eight

specific sites on the DNA template (Keikha, 2018,

Wong et al, 2018, and Soroka et al, 2021).

Primary LAMP design can be done using online

software such as Primer Explorer

(https://primerexplorer.jp/e/), LAMP Designer

Optigene (www.optigene.co.uk/lamp-designer), or

Premier Biosoft

(http://www.premierbiosoft.com/isothermal/lamp.ht

ml), maybe using the neb lamp

(https://lamp.neb.com/#!/) can be done either which

was used in this experiment (Wong et al, 2018 and

Soroka et al, 2021).

The LAMP technique does not involve DNA

denaturation because, due to the strand, as mentioned

earlier, transfer activity of the Bst DNA polymerase,

the reaction can be carried out under isothermal

conditions. All LAMP steps were done at a stable

temperature of 60–65 °C, eliminating the need to use

a thermocycler to precisely adjust the thermal and

time profiles, which are required for commonly

known PCR techniques (Keikha, 2018, Wong et al,

2018, and Soroka et al, 2021).

The Loop-Mediated Isothermal Amplification

method has been used to diagnose various infectious

diseases and identify and differentiate pathogenic

microorganisms; for example, Mycobacterium

tuberculosis, Nocardia spp., Pseudomonas

fluorescens, Staphylococcus aureus, Helicobacter

pylori, Salmonella species, and several other bacteria

and medically necessary viruses (Keikha, 2018).

2 MATERIALS AND METHODS

This study uses the insilico method, which uses

software and computational techniques to test the

scientific data we get from the existing literature.

First, we look for diseases prone to occur in the

Garuda Contingent sent to Congo by looking for

literature showing the prevalence of viral illness in

that country, by looking at the possibility of this viral

disease occurrence in our country. In addition,

Yellow Fever Virus has the same intermediate host as

the dengue virus, namely the Aedes aegypti

mosquitoes. It is necessary to take precautions so our

country does not become a yellow fever virus

endemic area (Gardner et al, 2010).

After obtaining data on this viral disease in the

country, we determined the genome of the Yellow

Fever Virus, YFV strain 17D genome (Genbank entry

NC_002031), which will be the target of this research

through existing journals. We found that the genome

is most similar to the original viral genome, primarily

found in Africa, and the most used as the object of

research (Nunes et al, 2015).

Next, we searched for the target gene in the

genome by searching literature which states that the

NS2a gene has a significant role in the virulence

factor of the virus. In addition, we chose the NS5 gene

because it has become the target gene in molecular

screening literature using PCR (Voßmann et al, 2015

and Rezende et al, 2019).

Then, we searched for the genome sequence at

https://www.ncbi.nlm.nih.gov/ using the Genbank

feature. Following that procedure, we take the

genome into FASTA format, obtain the complete line

of the genome, and input the sequence into the

Microsoft Word application.

After that, using https://lamp.neb.com/#!/, we

entered the gene sequence and determined the

location of the base pair sequence, which we will

make into a primer. After completing the process, we

obtained 6 new primers and confirmed that the base

pair sequence of the reverse primer and backward

primer had been reversed and complemented, which

are in the viral genome sequence in Microsoft Word.

ICOMESH 2023 - INTERNATIONAL CONFERENCE ON MEDICAL SCIENCE AND HEALTH

300

Then, the specificity of those 6 primers was tested

for the viral genome at

https://blast.ncbi.nlm.nih.gov/Blast.cgi, and the

results were those 6 primers specific for the Yellow

Fever Virus genome.

3 RESULTS

Literature studies showed that various genes,

including E and NS5 (Nunes et al, 2011), have been

used for targets using conventional PCR. Meanwhile

for isothermal PCR, only NS1 gene (Nunes et al,

2015 and Kwallah et al, 2013) and upstream non-

coding gene (Escadafal et al, 2014) have been used.

From the NS2a gene with length of 672 bp, 2 sets of

primers were obtained. First set, start from nc 3,636

and total region length of 207 bp. While the second

set, from nc 3,956 and total region length of 207 bp.

While NS5 with a longer length of 2,714 bp gave 4

sets of primers. Each starts from nc 8,159; 8,714;

9,589; 9,776 and total region length of 218 bp, 222

bp, 172 bp, and 234 bp respectively. BLASTN results

showed that all primers were specific to the YFV

genome. At the end, we have 6 primers that are

eligible and have a high possible success rate to be

the primers for the purpose of this experiment which

has been mentioned before.

Table 1: Primer 1.

len Tm

F3 20 60.22

TCGGGCAAGTAACTCTCCTT

B3 18 60.55 CCACCATGGCTGCTCCTA

Table 2: Primer 2.

len Tm

F3 19 60.89 CCCCTCATGGCTCTGTTGA

B3 19 59.24 GGTTGCCAGAAATGCACAC

Table 3: Primer 3.

len T

F3 20 59.70 GTTGACACCAGAGCAAAGGA

B3 20 59.17 CCAGAACTTTGGGTCTTGGA

Table 4: Primer 4.

len Tm

F3 20 59.68 GGGGTTGACAACTTCTGTGT

B3 19 60.52 GGACGCCTCATTCTCCTCA

Table 5: Primer 5.

len Tm

F3 20 60.58 TCCCACCACTTCCATGAACT

B3 18 59.33 CCATGAGGTGGGAACAGC

Table 6: Primer 6.

len Tm

F3 19 59.92 CACTGAGCACGGATGTGAC

B3 20 59.10 CTCCCAATCATTCCACCCTT

4 DISCUSSION

For screening purposes, primers design is the first

step and is crucial for making a diagnostic tool that

can be used in the field. In its application, other

reagents such as enzymes and other chemicals may

use existing ones. However, with different primers,

the purpose or function of the diagnostic tool will also

be different. Isothermal PCR is not a common

diagnostic tool, especially in the military medical

environment in Indonesia. It is very suitable for the

conditions of the military environment in Indonesia,

so it can easily apply this diagnostic test (Keikha,

2018, Wong et al, 2018, and Soroka et al, 2021).

Primers design, as the first step, has been

completed. Indeed, it will continue with the

manufacture of prototypes, in vitro testing, until it is

proven that screening using isothermal PCR is

possible by attaching data obtained directly from all

the tests. Suppose all series of tests have been carried

out, and it is found that the primers we obtained

computationally can be used as primers in this

diagnostic tool. In that case, a new faster, easier, and

cheaper way to detect the Yellow Fever Virus in

Indonesia will be obtained (Nunes et al, 2015).

Indeed, it has a good impact on military medicine

in Indonesia, because it proves that Indonesia can

already produce its own diagnostic tool for a virus

Novel Primers for Easy Detection of Yellow Fever Using Isothermal PCR

301

that can quickly spread in Indonesia because of our

soldiers who go directly to its endemic areas. This is

a big step that can be used as an opening door for the

advancement of military medicine, especially in the

molecular field, so that we can become a producer

independently, not just a consumer who depends on

other countries.

5 CONCLUSIONS

Yellow Fever is a disease caused by the Yellow Fever

Virus, which is common in tropical areas in Africa

and South America. By easy yet accurate technique,

there is a need to screen for possible YFV infection

among returning soldiers from the YFV endemic

countries such as Congo. Original primers have been

successfully designed for isothermal PCR of yellow

fever. Isothermal PCR/LAMP is an easy and

inexpensive technology that is rarely used, but it can

be used to screen for Yellow Fever disease by

detecting the base pairs in the viral DNA genome.

Primers designed are the first step and also the most

critical original works in nucleic acid testing. From

this work, 6 gene primers were obtained that could be

used as primers for the planned screening. Therefore,

towards self-sufficient diagnostic reagents, the results

are significant.

REFERENCES

Gardner, CL., Ryman, KD., 2010. Yellow fever: a

Reemerging threat. Clin Lab Med, 30(1), 237-60.

Nunes, MRT., Vianez, JL., Nunes, KNB., da Silva, SP.,

Lima, CPS., Guzman, H., Martins, LC., Carvalho, VL.,

Tesh, RB., Vasconcelos, PFC., 2015. Analysis of a

Reverse Transcription Loop-mediated Isothermal

Amplification (RT-LAMP) for yellow fever diagnostic.

Journal of Virological Methods, 226, 40-51.

Voßmann, S., Wieseler, J., Kerber, R., Kümmerer, BM.,

2015. A basic cluster in the N terminus of yellow fever

virus NS2A contributes to infectious particle

production. J Virol, 89(9), 4951-65.

Rezende, IM., Alves, PA., Arruda, MS., Gonçalves, AP.,

Oliveira, GFG., Pereira, LS., Dutra, MRT., Campi-

Azevedo, AC., Valim, V., Tourinho. R., Oliveira, JG.,

Calzavara, CE., Said, RFDC., Kroon, EG., Martins-

Filho, OA., Teixeira-Carvalho, A., Drumond, BP.,

2019. Yellow Fever Virus Genotyping Tool and

Investigation of Suspected Adverse Events Following

Yellow Fever Vaccination. Vaccines (Basel), 7(4), 206.

Keikha, M., 2018. LAMP Method as One of the Best

Candidates for Replacing with PCR Method. Malays J

Med Sci, 25(1), 121-123.

Wong, YP., Othman, S., Lau, YL., Radu, S., Chee, HY.,

2018. Loop-mediated isothermal amplification

(LAMP): a versatile technique for detection of

microorganisms. J Appl Microbiol, 124(3), 626-43.

Soroka, M., Wasowicz, B., Rymaszewska, A., 2021. Loop

Mediated Isothermal Amplification (LAMP): The

Better Sibling of PCR? Cells, 10(8), 1931.

Nunes, MR., Palacios, G., Nunes, KN., Casseb, SM.,

Martins, LC., Quaresma, JA., Savji, N., Lipkin, WI.,

2011. Vasconcelos PF. Evaluation of two molecular

methods for the detection of Yellow fever virus

genome. J Virol Methods, 174(1-2), 29-34.

Kwallah, Ao., Inoue, S., Muigai, AW., Kubo, T., Sang, R.,

Morita, K., Mwau, M., 2013. A real-time reverse

transcription loop-mediated isothermal amplification

assay for the rapid detection of yellow fever virus. J

Virol Methods, 193(1), 23-7.

Escadafal, C., Faye, O., Sall, AA., Faye, O., Weidmann, M.,

Strohmeier, O., von Stetten, F., Drexler, J., Eberhard,

M., Niedrig, M., Patel, P., 2014. Rapid molecular

assays for the detection of yellow fever virus in low-

resource settings. PLoS Negl Trop Dis, 8(3), e2730.

ICOMESH 2023 - INTERNATIONAL CONFERENCE ON MEDICAL SCIENCE AND HEALTH

302