Fast EvaGreen Real-time Duplex PCR for the Individual Detection

of Staphylococcus aureus and Bacillus cereus using a Uniform

Amplification Strategy

Nur Thaqifah Salihah

, Mohammad Mosharraf Hossain

and Minhaz Uddin Ahmed

Biosensors and Nanobiotechnology Laboratory, Integrated Science Building, Faculty of Science,

Universiti Brunei Darussalam, Jalan Tungku Link, Gadong BE 1410, Brunei

Institute of Forestry and Environmental Sciences, University of Chittagong, Chittagong 4331, Bangladesh

Keywords: Bacillus cereus, DNA, EvaGreen®, Foodborne Pathogens, Multiplex, Real-time PCR, Staphylococcus

aureus.

Abstract: Reliable and sensitive detection of Bacillus cereus (B. cereus) and Staphylococcus aureus (S. aureus) is

needed to limit the outbreak of food poisoning thereof. This paper reports the development of two individual

duplex real-time PCR assays with subsequent melting curve analyses based on EvaGreen

dye for dual gene

detections of two bacteria under uniform amplification condition. The duplex assays targeted thermostable

nuclease gene (nuc) and heat-shock protein gene (htrA) of S. aureus and non-haemolytic enterotoxin gene

(nhe) and cereolysin A gene (cerA) for B. cereus detection. The assays successfully detected both the species

with high specificity and sensitivity in genomic DNA samples and in simulated real milk samples. The

selectivity was also confirmed against a wide range of background microflora. Sensitivity of 500 cell/mL and

25 cell/mL of milk was obtained respectively for S. aureus and B. cereus. The proposed methodology allowed

for fast, inexpensive, selective and sensitive multi-targets detections of both bacteria in a single amplification

run on multiple genes to detect S. aureus and B. cereus in milk product by using dsDNA binding EvaGreen

dye.

1 INTRODUCTION

S. aureus and B. cereus – prevalent foodborne

pathogens – cause overlapping symptoms of

diarrhoea, vomiting, and abdominal pains (Bennett

and Monday, 2003; Rajkowski and Bennett, 2003)

and are potent to become epidemic. Culture-based

techniques, while inexpensive in confirming the

presence of these pathogens, are labourious and time

consuming – taking up to 5 or 8 days respectively for

S. aureus and B. cereus (Bennett and Lancette, 2012;

Tallent et al., 2012). It may also help pathogens to

reenter the environment because of false negative

results of viable but non-culturable pathogens that

retained their virulence (Gunasekera et al., 2002).

In recent years, alternate bacterial pathogens

detection techniques are developed to overcome the

issues presented by conventional culture-based

method such electrochemical, biosensor and real-time

PCR based detections (Ahmed et al., 2013; Safavieh

et al., 2012; 2013; 2014a; 2014b; Salihah et al., 2018;

2019; Tlili et al., 2013; Tolba et al., 2012). Real-time

PCR-based detection of infectious agents, especially

bacterial enteric pathogens, is becoming popular over

conventional culture-based and even gel-based PCR

techniques due to higher sensitivity, shorter

turnaround time, and enhanced environmental and

analyst safety. Faster detection is crucial to identify

the source to limit the spread of pathogens while

delays in detection may lead to their outbreaks. The

higher sensitivity of PCR-based detection reduces the

need for pre-enrichment or enrichment of bacteria and

limits the possibilities of re-introduction of the

bacterial pathogens into the environment (Martínez-

Blanch et al., 2009; Salihah et al., 2018; 2019).

However, PCR-based detection based on a single

marker gene has limited scope in identifying bacterial

pathogens because of the varying occurrence of genes

in different strains of targeted bacterial species

(Stenfors Aresen et al., 2008; Guinebretiére et al.,

2010) as well as due to the variations or deletions of

a marker gene at primer-binding sites

(Klaassen et al.,

2003), which may produce false-negatives results.

Salihah, N., Hossain, M. and Ahmed, M.

Fast EvaGreen Real-time Duplex PCR for the Individual Detection of Staphylococcus aureus and Bacillus cereus using a Uniform Ampliﬁcation Strategy.

DOI: 10.5220/0009985100002964

In Proceedings of the 16th ASEAN Food Conference (16th AFC 2019) - Outlook and Opportunities of Food Technology and Culinary for Tourism Industry, pages 197-204

ISBN: 978-989-758-467-1

197

Detecting more than a single gene marker can address

this. However, detection of multiple gene markers

individually requires more PCR consumables,

samples and time. On the other hand, multiplex

reactions allow the amplification of two or more

genes in a single tube with less amount of

consumables and samples. As with any real-time PCR

assays, multiplex real-time PCR reactions utilize

either sequence specific probe-based or the non-

specific dsDNA binding dyes fluorescence detection

chemistries

(Klaassen et al., 2003). While probe-

based chemistry is more specific and allow for

quantitative multiplex analysis, it is also more

expensive and difficult to design

(Salihah et al.,

2016). In contrary, the non-specific dsDNA (double-

stranded DNA) binding dyes offer a cheaper

alternative for multiplex reactions. However, due to

their unspecific affinity to any dsDNA, a post-

amplification melting curve analysis is required to

differentiate different targets’ amplicons which

makes multiplexing possible (Postollec et al., 2011;

Salihah et al., 2016).

This report describes the development of two

multiplex assays targeting two gene markers each for

S. aureus and B. cereus by using the EvaGreen

dye

chemistry. EvaGreen

dsDNA binding dye was

selected because it produces higher melting curve

resolution and unlike SYBR Green I, it does not bind

preferentially to GC-rich amplicons which can

adversely affect the multiplexing detection (Hu et al.,

2014; Giglio et al., 2003; Eischeid et al., 2011).

However, as a dsDNA binding dye, EvaGreen

fluoresce in the presence of any dsDNA, giving off

the same fluorescent signal. Therefore, all the

amplicons of multi-targets real-time PCR

amplification are differentiated by mean of the

amplicons’ unique T

. Several studies have proven

that multiplexed real-time PCR with dsDNA binding

dyes are possible by differentiating the amplicons of

the different targets by their T

values (Hu et al.,

2014; Safdar et al., 2015) which can be obtained

immediately and automatically after amplification

with zero additional handling with the current real-

time PCR instruments

(Salihah et al., 2016). Since

the post-PCR melting curve analysis further increases

the detection time, the protocol in this study used a

uniform set of conditions to amplify both S. aureus

and B. cereus’ multi-genes multiplex reactions in a

single run to reduce the detection time on both

bacteria. The use of rapid cycle amplification

protocol further reduced the detection time. Hence,

this study successfully developed a fast, sensitive, and

specific real-time multiplex PCR method to amplify

two gene targets for specific detection of S. aureus

and B. cereus with EvaGreen

dye chemistry under a

single amplification condition without pre-

enrichment step.

2 MATERIALS AND METHODS

2.1 Genomic DNA of Bacterial Strains

This study used Genomic DNA purchased from

American Type Culture Collection (ATCC,

Manassas, USA) listed in Table 1, both as reference

strains and cross-reactivity analysis. The

concentration and purity of the genomic DNA was

measured by NanoPhotometer

P-Class (Implen,

Munchen, Germany) spectrophotometer by reading

off the absorbance at 260 nm and the absorbance

260

280

ratio, respectively. The genomic DNAs

were then diluted with 1 × TE buffer to appropriate

concentrations before use.

2.2 Bacterial Cultivations and Cell

Counting

The S. aureus ATCC 25923 and B. cereus ATCC

14579 live bacterial strains were obtained from

Microbiologics Inc (Minnesota, USA). They were

cultured in LB broth, Miller (Fisher Scientific,

Pittsburgh, USA) at 30

C for 48 hours. The total cell

count of the culture was determined with a Neubauer

haemocytometer (Hausser Scientific, Horsham,

USA) before inoculating food products with them and

their subsequent extractions. The culture broth was

concentrated by centrifuging followed by removal of

the supernatant broth and addition of 10 mL of 1 ×

PBS. 1 mL of the cultured broth was heat treated at

100

C for 10 minutes for safe handling and counting.

The heat-treated culture was then serially diluted with

1 × PBS buffer and counted with haemocytometer for

at least three times. The non-treated cultured broth

was then diluted with 1 × PBS buffer to appropriate

concentration before used to inoculate real-food

sample.

2.3 Oligonucleotides Design and

Selections

The oligonucleotides designed and selected for this

study are listed on Table 2. The two primer pairs were

selected to target nhe and cerA of B. cereus, and nuc

and htrA genes for S. aureus. To ensure that the

duplex assays for S .aureus and B. cereus are specific,

in-silico

analysis with Primer-Blast (National Centre

16th AFC 2019 - ASEAN Food Conference

198

Table 1: Bacterial strains used in this study.

Bacteria Strain

no.

Cross-reactivit

anal

sis

S. aureus

duplex

B. cereus

duplex

nuc htrA nhe cerA

Staphylococcus

aureus

ATCC

25923

+ + - -

Bacillus cereus ATCC

14579

- - + +

Legionella

pneumophila

ATCC

33152

- - - -

Bacillus

ubtilis

ATCC

23857

- - - -

Salmonella

enterica

ATCC

13311

- - - -

Escherichia

coli

ATCC

25922

- - - -

Clostridium

perfringens

ATCC

35401

- - - -

Shigella

lexneri

ATCC

13124

- - - -

Campylobacter

uni

ATCC

33292

- - - -

Yersinia

enterocolitoca

ATCC

27739

- - - -

Aeromonas

hydrophila

ATCC

7966

- - - -

Plesiomonas

elloides

ATCC

51903

- - - -

Streptococcus

pyogens

ATCC

19615

- - - -

Cronobacter

sakazakii

ATCC

BAA-

894

- - - -

Mycobacterium

avium

ATCC

BAA-

968

- - - -

for Biotechnology Information, http://www.ncbi.nlm.

nih.gov/) and OligoAnalyzer Tool (IDT) was carried

out.

The suitability of the assays was first analyzed by

singleplex real-time PCR. Briefly, the assays were

reacted in a 25 µL PCR mixture that contained

Ultrapure MilliQ water, 1 of Buffer II, 250 nM of

both the forward and reverse primers, 1.5 mM MgCl

0.2 mM of dNTP mix (Invitrogen

™

Lifetechnologies,

Van Allen Way, U.S.A.), 0.1 ROX reference dye

(Invitrogen

™

Life technologies), 1  EvaGreen

dye,

0.625U of AmpliTaq DNA polymerase (Applied

Biosystem

™

Life technologies, Van Allen Way,

U.S.A.) and 3 µL of DNA template and were run in

duplicates. The amplifications were carried out on the

7500 Fast real-time PCR system (Applied

Biosystem

™

Lifetechnologies, Van Allen Way,

U.S.A.). Fast cycle amplifications were conducted

with the singleplex analysis with the initial

denaturation at 95

C for 20 seconds, and 40 cycles of

denaturation at 95

C for 3 seconds followed by

Annealing/extension for 30 seconds at 60

A step-hold melting curve analysis was also

performed after amplifications by heating the PCR

mixture at 95

C for 15 seconds, and then lowering to

C for 1 minute. The temperature was then

increased to 95

C for 30 seconds and the

fluorescence signal was monitored at this

temperature. The PCR mixtures were then cooled to

C for 15 seconds.

Table 2: List of primer pairs and probes designed and

selected.

Primer

name

Sequence

(5’-3’)

Product

size

(bp

)

Product

GC (%)

Reference

BCcera F TGGAACTGGAAAGGTACG 200 42.5 This

study

R GTAACACGTTGTGCATC

BCnhe F GCATCCAAGAGAGTATGG 186 32.2

R GTTCAGCTTGAATTTCC

SAnuc F AATATGGACGTGGCTTAGCG 196 35.7 Salihah et

al., 2019

R TGACCTGAATCAGCGTTGT

SAhtra F CGTAAGCGTCGTGAATTCTTC

208 30 This

study

R CTTCAGCTTTATTCTCATTAACATCACG

2.4 Development of Duplex Real-time

PCR Assays

The duplex real time PCR reactions were

subsequently reacted in 25 µL of PCR master mix

prepared with Ultrapure MilliQ water containing 1

of Buffer II, 100 nM of each primer pairs for B. cereus

duplex reaction whereas 80 nM and 100 nM for nuc

and htrA primer pairs respectively for S. aureus

duplex reaction, 4 mM MgCl

, 0.4 mM of dNTP mix

(Invitrogen

™

Lifetechnologies, Van Allen Way,

U.S.A.), 0.1  ROX reference dye (Invitrogen

™

Life

technologies), 1  EvaGreen

dye, 1.25 U of

AmpliTaq DNA polymerase (Applied Biosystem

™

Life technologies, Van Allen Way, U.S.A.) with 6 µL

or 8 µL of DNA template for S. aureus and B. cereus

respectively. The duplex real-time PCR

amplifications were performed on the same 7500 Fast

real-time PCR system (Applied Biosystem

™

Lifetechnologies, Van Allen Way, U.S.A.) in fast

cycle amplification. Step-hold melting curve analysis

was performed after the amplification, as previously

described. All real-time reactions were performed in

either duplicates or triplicates.

2.5 Qualitative Detection in Milk

A 10-fold serial dilution of B. cereus ATCC 14579

and S. aureus ATCC 25923 cultures with 1  PBS

Fast EvaGreen Real-time Duplex PCR for the Individual Detection of Staphylococcus aureus and Bacillus cereus using a Uniform

Ampliﬁcation Strategy

199

buffer yielded 1 to 1 × 10

cells/μL. For B. cereus and

S. aureus detection in real samples, 200 μL milk

samples were artificially contaminated with 1 μL

serial dilutions of B. cereus ATCC 14579 and S.

aureus ATCC 25923 cultures DNA was extracted

from the milk matrix DNeasy Blood and Tissue kit

(Qiagen GmbH, Hilden, Germany) previously

described in Salihah et al. (2019). Genomic DNA

from food matrix was extracted by a combination of

boiling method and DNeasy Blood and Tissue kit

(Qiagen GmbH, Hilden, Germany). The protocol was

modified as follows: 200 μL of the sample was

centrifuged for 30 minutes at 14,000 rpm. The pellet

was washed twice with 500 μL of 1 × TE buffer (pH

8.0) before re-suspending in 200 µL of 1 × TE buffer.

It was then incubated at 99

C for 15 minutes before

lysis with 200 µL of AL buffer (containing guanidium

chloride, supplied by the kit) and 25 µL Qiagen

Proteinase K at 70

C for 30 minutes. After heating,

200 μL of 99.8 % ethanol (Sigma-Aldrich, Singapore)

was added to the sample and vortexed thoroughly.

The mixture was then pipetted into the DNeasy Mini

spin column (supplied by the kit) with 2 mL

collection tube attached. The column was then

centrifuged at 8,000 rpm for 1 minute, collection tube

and flow-through were then discarded and replaced

with clean new collection tubes (supplied by the kit).

Then the column and centrifuge at 8,000 rpm for 1

minute after addition of 500 μL of AW1 buffer

(containing ethanol and guanidium chloride, supplied

by kit). The liquid in the collection tube was then

discarded. Clean and new collection tube was

attached to the column and 500 μL AW2 buffer

(containing ethanol, provided by the kit) was run

through the column followed by a 3-minute

centrifugation at 14,000 rpm. Collection tube was

discarded and the column was transferred to 1.5 mL

autoclaved and UV irradiated microcentrifuge tube.

The template was eluted once from the column with

40 µL AE buffer (containing 10 mM Tris-Cl and 0.5

mM EDTA, pH 9, supplied by the kit) whereas, for S.

aureus DNA extraction, the template was eluted once

from the column with 60 μL AE buffer. The column

was then incubated at room temperature for 1 minute

before centrifugation at 8,000 rpm for 1 minute

3 RESULTS AND DISCUSSION

3.1 Oligonucleotides Design and

Selections

It is necessary to target for than a single gene when

using PCR-based methods such as real-time PCR.

This is because single gene detections be limiting due

to the varying occurrence of genes in different strains

of the same bacterial species. For example, the nhe

and cerA genes used for B. cereus detection, are

present in 65-75% and 90-95% of B. cereus strains

respectively (De Santis et al., 2008; Martínez-Blanch

et al., 2009). While, nuc gene that encodes the S.

aureus specific thermostable nuclease enzyme which

has been used to confirm the presence of S. aureus in

culture-based detection

were found in only 75-78%

of phenotypically positive S. aureus strains in milk

and porcine products (Salem-Bekhit et al., 2010;

Velasco et al., 2018). While htrA gene is consistently

found in all S. aureus strains (Chiang et al., 2007;

Cremonsi et al., 2014), the study on htrA gene

prevalence in S. aureus strains is very limited in

comparison to the more commonly used nuc gene.

Targeting more than a single gene is necessary in

comprehensively identifying S. aureus and B. cereus

with real-time PCR.

The primers sequences designed in Table 2 for S.

aureus’ nuc and htrA genes and B. cereus’ cerA and

nhe genes were analyzed against the sequences in the

Genbank database. They were found to be specific to

only the target bacteria strains.

Figure 1: Melting curve analysis

of singleplex

amplifications of (A) B. cereus’ nhe and cerA genes and (B)

S. aureus’ nuc and htrA genes.

The suitability of the assays were further analyzed

in a singplex reactions to ensure that they would

produce distinctive T

s in the melting curve analysis

for the multiplex reactions. The amplicons (for

positive controls) produced single distinguishable

melting peaks for both B. cereus’s nhe and cerA at

74.2 ± 0.151

C and 80.0 ± 0.153

C respectively

(Figure 1A) and S. aureus’s htrA and nuc genes at

78.2 ± 0.096

C and 81.3 ± 0.154

C respectively

(Figure 1B), which proved the suitability of dsDNA

binding EvaGreen

dye as the detection chemistry for

duplex reactions targeting dual genes of both B.

cereus and S. aureus.

16th AFC 2019 - ASEAN Food Conference

200

3.2 Development of Duplex Real-time

PCR Assays

Since, dsDNA binding EvaGreen

dye was used,

post-PCR melting curve analysis were performed to

ensure that each target in the duplex S. aureus and B.

cereus reactions are distinguishable. Both of the

duplex reactions showed that B. cereus’ nhe (T

78.7 ± 0.136

C) and cerA (T

= 83.8 ± 0.0783

C) and

S. aureus’ nuc (T

= 78.1 ± 0.151

C) and htrA (T

83.8 ± 0.153

C) amplification produce distinct and

easily identifiable melting peaks (Figure 2). Each

amplifications produced primer-dimers for the

negative controls of both S. aureus and B. cereus

duplex real-time PCR reactions. However, the

primer-dimer T

peaks were lower for both the target

genes and were easily differentiated from the target

amplicons’ T

peaks.

So they are suitable for the multiplex reaction with

the EvaGreen

dye. The variation in T

of the

amplicons are dependent on base compositions and to

some extent the length of the amplicons

(Nitsche,

2007). This study found that despite the relatively

same amplicon lengths of both the targets for S.

aureus and B. cereus duplex detections - the

experimented amplicons’ T

were distinctively

different. Since the lengths are relatively similar, the

guanine and cytosine nucleobases content of the

amplicons that contributes more to their T

difference

(Haynie, 2001). As shown in Table 2, the amplicons

with higher GC content (B. cereus’ BCcerA and S.

aureus’ SAnuc) have higher T

values in comparison

to amplicons with lower GC content (B. cereus’

BCnhe and S. aureus’ SAhtrA). The reason for this

correlation is that nucleobases guanine and cytosine

pairs form three hydrogen bonds, which stabilizes the

DNA double-helix structure more than the two

hydrogen bonds formed by nucleobases adenine and

thymine pairs (Marmur and Doty, 1962; Tropp,

2008). Thus, DNA with higher GC content requires

more energy to break the triple hydrogen bonds and

thus have higher T

(Marmur and Doty, 1962).

However, the addition of post-PCR melting curve

analysis will add to the detection time. Therefore to

compensate, the proposed duplex assays (S. aureus

duplex and B. cereus duplex) were specifically design

to amplify with the same fast protocol amplification

condition, which takes about approximately 30

minutes before post-PCR melting curve analysis.

Thus, both duplex assays can run at the same time to

reduce the detection time and to streamline the

process for detection of both S. aureus and B. cereus

in a single run.

Figure 2: Melting curve analysis for the assay for fast cycle

amplification of (A) B.cereus, (B) S. aureus.

3.3 Sensitivity and Cross-reactivity

Analysis

The sensitivity of the dual targets individual

detections of S. aureus and B. cereus were analyzed

for fast amplification protocol. The results of the

sensitivity tests are listed in Table 3 for both B. cereus

and S. aureus detection.

Table 3: Sensitivity analysis results for individual duplex

detections of B. cereus and S. aureus.

Bacterial

tar

Gene LOD

(

/reaction

)

Probability

(

)

B. cereus nhe 6.0×10

50.0

cerA 6.0 100.0

S. aureus nuc 3.0×10

83.3

htrA 3.0×10

50.0

The cross-reactivity of the duplex assays for fast

cycle amplifications were tested against the other

bacterial species listed in Table 1. The post-PCR

melting curve analysis did not show any specific T

peaks for bacterial species other than the peaks for

positive controls (B. cereus ATCC 14579 and S.

aureus ATCC 24923). The overall table view of the

cross-reactivity results is listed in Table 1 for B.

cereus and S. aureus multiplex reactions.

Therefore, even though combining the fast

amplification cycle and multiplexing decrease the

sensitivity of the assay, relatively high sensitivities

were still obtained for both S. aureus and B. cereus’

duplex assays. The B. cereus duplex’s limits of

detections (LODs) were 1 cell/reaction and 10

cell/reaction for cerA and nhe genes, respectively.

Whereas for S. aureus duplex the LODs of 10

cell/reaction and 100 cell/reaction for nuc and htrA

genes, respectively. The sensitivity obtained for both

Fast EvaGreen Real-time Duplex PCR for the Individual Detection of Staphylococcus aureus and Bacillus cereus using a Uniform

Ampliﬁcation Strategy

201

duplex assays are comparable to the sensitivity

obtained for the previous singleplex B. cereus and S.

aureus detection (Salihah et al., 2018; Salihah et al.,

2019).

Furthermore, both the duplex assays are highly

specific to B. cereus and S. aureus, free from cross-

reactivity with other bacterial species in-silico and in-

vitro (Table 1). Thus both duplex is highly specific

and fairly sensitive.

3.4 Qualitative Detection in Milk

The suitability of the proposed dual gene targets

detection of both S. aureus and B. cereus was further

evaluated with simulated milk samples under the fast

cycle amplification condition for simultaneous

detection of S. aureus and B. cereus in a single run. S.

aureus and B. cereus DNAs were directly extracted

from milk samples and were then amplified and

detected by individual duplex assays in separate PCR

tubes and were analyzed together under a single

amplification condition. This allowed simultaneous

detection of dual gene targets of S. aureus and B.

cereus.

The assay detected S. aureus in milk samples

having at least 10 cells/reaction while nuc gene was

targeted while at least 100 cells/reaction was required

when htrA gene was targeted. The sensitivity

obtained for nuc and htrA gene were comparable to

those observed in the sensitivity analysis with pure

genomic DNA dilutions (Table 3). Hence, the

proposed assay claims the capability of detecting S.

aureus with as low as 500 cells/mL of simulated milk

sample. On the other hand, for B. cereus detection

sensitivity of 1 cell/reaction was observed for cerA

gene and 10 cells/reaction for nhe gene. This was

equivalent to 25 cells of B. cereus in 1 mL of

artificially inoculated milk.

This indicated the suitability of the assays to

detect target bacterial pathogens against background

microflora in complex food products such as milk.

The suitability were tested practically by using the no

pre-enrichment and no-expensive enzymes lysis

method of an adapted Qiagen DNeasy blood and

tissue kit previously developed by Salihah et al.

(2019). This further reduced detection time (direct

detection without the need of the additional pre-

enrichment step) and cost (no need to use expensive

enzyme lysis).

4 CONCLUSION

Therefore, we developed a real-time PCR dual gene

B. cereus and S. aureus detections system using a

single set of amplification condition to run two

individual duplex assays with EvaGreen

dye. The

assays demonstrated a highly specific and sensitive

detection of both gene targets of each species and

showed highly specific amplification against a large

set of background microflora. Further analysis is

needed to assess the applicability of the proposed

assay against at least five different strains of S. aureus

and B. cereus to validate both assays according to ISO

16140. Since, analysis of the T

of the amplicons was

a part of the detection method - the reproducibility

(i.e. inter- and intra-assay) of the amplicons’ T

needed to be calculated from a range of B. cereus and

S. aureus strains, as shown by Wehrle and colleagues

(2010). In addition, it might need to demonstrate the

capability of the multiplexed assays in detecting a

wide range of strains, and in case of B. cereus

multiplex assay, an inclusion of other enterotoxigenic

B. cereus strains might be tested. Furthermore, an

inclusion of other target genes for both B. cereus and

S. aureus in the assay might help to find more genetic

indicators of the bacterial pathogens. Primer pairs

could have been designed to target the hbl, cytk1 and

ces genes (Wehrle et al., 2009; Wehrle et al., 2010) to

measure the enteropathogenic potential of B. cereus

strains. For S. aureus multiplex detection, the

inclusion of primer pairs targeting the enterotoxin

gene cluster (egc), enterotoxin genes sea, seb, sec,

sed, see, entC as well as S. aureus specific femA gene

(Tamarapu et al., 2001; Pelisser et al., 2009; Fusco et

al., 2011) could be considered.

Overall, the use of dsDNA binding dyes like

EvaGreen

dye in this study provides an advantage

over probe-based chemistry as it is not only easier to

design and cheaper but also free from the limitation

of unavailability of compatible probe-dyes for current

real-time PCR instruments

(Agindotan et al., 2007).

In conclusion, the study claims to develop a highly

specific and sensitive multiplex assay to detect two

target genes of both B. cereus and S. aureus. This

multiplex assay was cost-effective as it used

EvaGreen

dyes chemistry and as both multiplex

reactions were run under a single amplification

condition which gave the benefit of streamlining the

detection of B. cereus and S. aureus.

16th AFC 2019 - ASEAN Food Conference

202

ACKNOWLEDGEMENTS

Nur Thaqifah Salihah would like to thank the

Ministry of Education, Brunei Darussalam for the

opportunity given to undertake a Ph.D programme at

Universiti Brunei Darussalam (UBD).

REFERENCES

Agindotan, B.O., Shiel, P.J., Berger, P.H., 2007. Simultaneous

detection of potato viruses PLRV, PVA, PVX and PVY

from dormant potato tubers by Taqman

real-time RT-

PCR. Journal of Virological Methods, 142, 1-9.

Ahmed, M.U., Nahar, S., Safavieh, M., Zourob M., 2013. Real-

time electrochemical detection of DNA using electrostatic

interaction of redox probe. Analyst, 138 (3), 907-91.

Applied Biosystem, N.D. Applied Biosystem 7500 Fast and

7500 Real-time systems: Specification Sheet.

Bennett, R.W., Lancette, G.A., 2012. ‘Staphylococcus aureus’

in Lampel, K.A., Al-Khaldi, S., Cahill, S.M. (eds).

Bacteriological Analytical Manual. 8

edition. Available

at: https://www.fda.gov/food/laboratory-methods-

food/bam-staphylococcus-aureus . (Accessed date: 10

June 2019).

Bennett, R.W., Monday, S.R., 2003. ‘Staphylococcus aureus’

in Miliotis, M.D., Bier, J.W. (eds). International handbook

of foodborne pathogens, Marcel Dekker. New York.

Cremonesi, P., Pisani, L.F., Lecchi, C., Ceciliani, F., Martino,

P., Bonastre, A.S., Karus, A., Balzaretti, C., Castiglioni, B.,

2014. Development of 23 individual TaqMan

real-time

PCR assays for identifying common foodborne pathogens

using single set of amplification conditions. Food

Microbiology, 43, 35-40.

Chiang, Y., Fan, C., Liao, W., Lin, C., Tsen, H., 2007. Real-

time PCR detection of Staphylococcus aureus in milk and

meat using new primers designed from the heat shock

protein gene htrA sequence. Journal of Food Protection,

70(12), 2855-2859.

De Santis, E.P.I., Foddai, A., Virdis, S., Marongiu, P., Pilo,

A.L., Scarano, C., 2008. Toxin gene pattern in Bacillus

cereus group strains isolated from sheep ricotta cheese.

Veterinary Research Communications,32, S323-S326.

Eischeid, A.C., 2011. SYTO dyes and EvaGreen outperform

SYBR Green in real-time PCR. BMC Res Notes, 4, 263.

Fusco, V., Quero, G.M., Morea, M., Blaiotta, G., Visconti, A.,

2011. Rapid and reliable identification of Staphylococcus

aureus harbouring the enterotoxin gene cluster (egc) and

quantitative detection in raw milk by real-time PCR.

International Journal of Food Microbiology, 144(3), 528-

537.

Giglio, S., Monis, P.T., Saint, C.P., 2003. Demonstration of

preferential binding of SYBR Green I to specific DNA

fragments in real-time multiplex PCR. Nucleic Acids

Research, 31(22), e136.

Guinebretiére, M.H., Velge, P., Couvert, O., Carlin, F.,

Debuyser, M.L., Nguyen-The, C., 2010. Ability of

Bacillus cereus group strains to cause food poisoning

varies according to phylogenetic affiliation (group I to VII)

rather than species affiliation. Journal of Clinical

Microbiology, 48(9), 3388-3391.

Gunasekera, T.S., Sørensen, A., Attfield, P.V., Sørensen, S.J.,

Veal, D.A., 2002. Inducible gene expression by

nonculturable bacteria in milk after pasteurization. Applied

and Environmental Microbiology, 68, 1988-1993.

Haynie, D.T., 2001. Biological thermodynamics, Cambridge

University Press, Cambridge.

Hu, Z., Zhu, C., Chang, H., Guo, W., Liu, D., Xiang, W.,

Wang, X., 2014. Development of a single-tube duplex

EvaGreen real-time PCR for the detection and

identification of EHV-1 and EHV-4. Applied Microbiology

and Biotechnology, 98(9), 4179-4186.

Klaassen, C.H.W., de Valk, H.A., Horrevorts, A., 2003.

Clinical Staphylococcus aureus isolate negative for Sa442

fragment. Journal of Clinical Microbiology, 41(9), 4493.

Martínez-Blanch, J.F., Sánchez, G., Garay, E., Aznar, R., 2009.

Development of a real-time PCR assay for detection and

quantification of enterotoxigenic members of Bacillus

cereus group in food samples. International Journal of

Food Microbiology, 135, 15-21.

Marmur, J., Doty, P., 1962. Determination of the base

composition of deoxyribonucleic acid from its thermal

denaturation temperature. Journal of Molecular Biology,

5, 109-118.

Nitsche, A., 2007. ‘Oligonucleotide design for in-house real-

time PCR applications in microbiology’ in Mackay, I.M.

(ed). Real-time PCR in microbiology: From diagnostic to

characterization, Caister Academic Press. Norfolk.

Pelisser, M.R., Klein, C.S., Ascoli, K.R., Zotti, T.R., Arisi,

A.C.M., 2009. Occurrence of Staphylococcus aureus and

multiplex PCR detection of classic enterotoxin genes in

cheese and meat products. Brazilian Journal of

Microbiology, 40(1), 145-148.

Postollec, F., Falentin, H., Pavan, S., Combrisson, J., Sohier,

D., 2011. Recent advances in quantitative PCR (qPCR)

applications in food microbiology. Food Microbiology,

28(5), 848-861.

Rajkowski, K.T., Bennett, R.W., 2003. ‘Bacillus cereus’ in

Miliotis M.D., Bier J.W. (eds). International handbook of

foodborne pathogens, Marcel Dekker. New York.

Safavieh, M., Ahmed, M.U., Sokullu, E., Ng, A., Braescu, L.,

Zourob, M., 2014. A Simple Cassette as Point-of-Care

Diagnostic Device for Colorimetric Bacteria Detection.

Analyst, 139, 482-487.

Safavieh, M., Ahmed, M.U., Zourob, M., 2012.

Electrochemical assay in microfluidic for rapid detection

and quantification of Escherichia coli. Biosensors and

Bioelectronics, 31(1), 523-528.

Safavieh, M., Ahmed, M.U., Zourob, M., 2013. High

throughput low cost electrochemical device for S. aureus

bacteria detection. IEEE Sensors,1-4.

Safavieh, M., Ahmed, M.U., Zourob, M., 2014. High

throughput Real time Electrochemical monitoring of

LAMP Using a Redox for Pathogenic Bacteria Detection.

Biosensors and Bioelectronics, 15(58), 101-106.

Safdar, M., Junejo, Y., 2015. Development and validation of

fast duplex real-time PCR assays based on SYBR Green

Fast EvaGreen Real-time Duplex PCR for the Individual Detection of Staphylococcus aureus and Bacillus cereus using a Uniform

Ampliﬁcation Strategy

203

florescence for detection of bovine and poultry origins in

feedstuffs. Food Chemistry, 173, 660-664.

Salem-Bekhit, M.M., Muharram, M.M., Alhosiny, I.M.,

Hashim, M.E.S.Y., 2010. Molecular detection of genes

encoding virulence determinants in Staphylococcus aureus

strains isolated from bovine mastitis. Journal of Applied

Science Research, 6(2), 121-128.

Salihah, N.T., Hossain, M.M., Abdul Hamid, M.R.W., Ahmed,

M.U., 2018. A comparison of ZEN double-quenched

probe and SYBR GreeER chemistries in the real-time PCR

based quantitative detection of enterotoxigenic Bacillus

cereus in milk. Malaysian Journal of Microbiology, 14(1),

34-40.

Salihah, N.T., Hossain, M.M., Abdul Hamid, M.R.W., Ahmed,

M.U., 2019. A novel, rapid, and sensitive real-time PCR

assay for cost-effective detection and quantification of

Staphylococcus aureus in food samples with ZEN™

double-quenched probe chemistry. International Foor

Research Journal, 26(1), 193-201.

Salihah, N.T., Hossain, M.M., Lubis, H., Ahmed, M.U., 2016.

Trends and Advances in Food Analysis Using Real Time

Polymerase Chain Reaction. Journal of Food Science and

Technology, 53(5), 2196–2209.

Stenfors Arnesen, L.P., Fagerlund, A., Granum, P.E., 2008.

From soil to gut: Bacillus cereus and its food poisoning

toxins. FEMS Microbiology Reviews, 32(4), 579-606.

Tallent, S.M., Rhodehamel, E.J., Harmon, S.M., Bennett,

R.W., ‘Bacillus cereus’ in Lampel, K.A., Al-Khaldi, S.,

Cahill, S.M. (eds). Bacteriological Analytical Manual. 8

edition. Available at:

https://www.fda.gov/food/laboratory-methods-food/bam-

staphylococcus-aureus . (Accessed date: 10 June 2019).

Tamarapu, S., McKillip, J.L., Drake, M., 2001. Development

of a Multiplex Polymerase Chain Reaction assay for

detection and differentiation of Staphylococcus aureus in

dairy products. Journal of Food Protection, 64(5), 664-

668.

Tlili, C., Sokullu, E., Safavieh, M., Tolba, M., Ahmed, M.U.,

Zourob, M., 2013. Bacteria Screening, Viability, And

Conﬁrmation Assays Using Bacteriophage-

Impedimetric/Loop-Mediated Isothermal Ampliﬁcation

Dual-Response Biosensors. Analytical Chemistry, 85 (10),

4893–4901.

Tolba, M., Ahmed, M.U., Tlili, C., Eichenseher, F., Loessner,

M.J., Zourob, M., 2012. Bacteriophage endolysin-based

electrochemical impedance biosensor for the rapid

detection of Listeria cells. Analys, 137, 5749-5756.

Tropp, B.E., 2008. Molecular biology: Genes to proteins,

Jones and Bartlett publisher. Massachusetts.

Velasco, V., Vergara, J.L., Bonilla, A.M., Muñoz, J., Mallea,

A., Vallejos, D., Quezada-Aguiluz, M., Campos, J., Rojas-

García, P., 2018. Prevalence and Characterization of

Stapylococcuss aureus Strains in the Pork Chain Supply in

Chile. Foodborne Pathogens Diseases, 15(5), 262-268.

Wehrle, E., Didier, A., Moravek, M., Dietrich, R., Märtlbauer,

E., 2010. Detection of Bacillus cereus with

enteropathogenic potential by multiplex real-time PCR

based on SYBR Green I. Molecular Cell Probes, 24(3),

124-130.

Wehrle, E., Moravek, M., Dietrich, R., Bürk, C., Didier, A.,

Märtlbauer, E., 2009. Comparison of multiplex PCR,

enzyme immunoassay and cell culture methods for the

detection of enterotoxigenic Bacillus cereus. Journal

Microbiological Methods, 78(3), 265-270.

16th AFC 2019 - ASEAN Food Conference

204