Cloning, Expression and Purification of Glutathione Peroxidase of

Antarctic Yeast Rhodotorula mucilaginosa AN5

Hai Yu

, Cuijuan Shi

, Xiujun Gao

and Guangfeng Kan

2,* d

Weihai Science and Technology Innovation Development Center, Weihai, Shandong, China

School of Marine Science and Technology, Harbin Institute of Technology at Weihai, Weihai, Shandong, China

gfkan@hit.edu.cn

Keywords: Antarctic Yeast, Glutathione Peroxidase, Cloning and Expression, Protein Properties.

Abstract: Glutathione peroxidase (GPx) is a key enzyme in glutathione antioxidant enzyme system, which can remove

H2O2 and other oxidants in organisms. In this study, the GPx gene was cloned, sequence analyzed,

prokaryotic expressed and purified from Antarctic yeast Rhodotorula mucilaginosa AN5. The GPx gene

sequence was amplified successfully by PCR and named RmGPx (GenBank No. KX164292). The open

reading frame (ORF) of RmGPx was 498 bp and encoded 165 amino acids. The predicted molecular weight

of the protein was 18268.6 Da and the theoretical isoelectric point was 8.37. The recombinant expression

plasmid pET-28a-RmGPx was successfully constructed and transferred to E. coli. The protein expression

was the optimum when induced by 0.2 mM IPTG at 37 ℃ for 4 hours. The protein was purified by an

elution buffer of 100 mM imidazole in Ni NTA column. All study results supply the theoretical foundation

for the functional analysis and application of GPx protein.

INTRODUCTION

Glutathione peroxidase (GPx) catalyzes the

reduction of hydrogen peroxide by GSH and was

first discovered in bovine erythrocytes (Mills 1957).

Reactive oxygen species (ROS) are chemically

active small molecules formed in the process of

aerobic respiration and substrate oxidation. They

participate in many biological processes, such as

stimulating signal transduction, mediating cell

apoptosis and defending against pathogen invasion

(Bathige et al 2015). Trace ROS is indispensable in

many biochemical processes, while excess ROS will

cause cellular damages, such as DNA strand

breakage, protein oxidation, polysaccharide

depolymerization, membrane peroxidation and

signal trans-duction damage (Zhang et al 2015). In

order to remove excess ROS and maintain redox

balance in cells, aerobic organisms have evolved

various non-enzymatic and enzymatic antioxidant

systems including GPx (

Matés 2000

https://orcid.org/0000-0002-7829-8578

https://orcid.org/0000-0001-9563-1259

https://orcid.org/0000-0002-5008-4789

https://orcid.org/0000-0002-5357-7204

GPx can scavenge free radicals, participate in

signal transduction and immune response, and plays

an important role in biological stress adaptation

(Zhang et al 2018, Li et al 2021). In Arabidopsis

and yeasts, the growth is inhibited by H

produced by environmental stress, while catalase,

ascorbate peroxidase and GPx can eliminate them

and maintain metabolism balance (Smirnoff and

Arnaud 2018). Zhang et al discovered that in corn

(Zea mays L.) seedlings treated with polystyrene

nanoplastics, the antioxidant enzyme activity of

superoxide dismutase and GPx increased obviously,

which indicated glutamate metabolic pathways

appear to be closely related to plant mechanisms for

tolerance/detoxification of nanoplastics (Zhang et al

2021).

As well known, Antarctic behaves in harsh

environmental conditions. With the changes of air

temperature and snow cover, sea ice is highly

variable by strong gradients in temperature, salinity,

space, and light (

Thomas, Dieckmann, 2002

Sea-ice microorganisms suffer huge environmental

stresses, which result in the cellular metabolism

imbalance and active oxygen generation. So, polar

organisms frequently produce more antioxidants or

antioxidases to maintain the redox equilibrium

Yu, H., Shi, C., Gao, X. and Kan, G.

Cloning, Expression and Puriﬁcation of Glutathione Peroxidase of Antarctic Yeast Rhodotorula mucilaginosa AN5.

DOI: 10.5220/0011232500003443

In Proceedings of the 4th International Conference on Biomedical Engineering and Bioinformatics (ICBEB 2022), pages 553-557

ISBN: 978-989-758-595-1

553

(

Núñez-Pons et al 2018

). In this study, GPx gene

was amplified by PCR from Antarctica yeast AN5.

The recombinant expression plasmid was

constructed, and the optimum induction expression

and purification conditions of recombinant protein

were analyzed. The study lays a foundation for the

properties and functions analysis of GPx protein,

and provides a reference for revealing

environmental adaptation mechanisms of extreme

organisms.

2 MATERIALS AND METHODS

2.1 Microorganisms and Growth

Antarctic yeast R. mucilaginosa AN5 was isolated

from Antarctic sea ice collected by the 23

Chinese

Antarctic Scientific Expedition. Yeast AN5 was

grown in YEPD medium at 20 °C in an orbital

shaker of 120 rpm. E. coli were kept in LB medium

at 37 °C.

2.2 Cloning and Sequencing of GPx

Gene

The yeast cells were collected by centrifugation and

ground with a mortar and pestle in liquid nitrogen.

Total RNA was extracted following the instruction

of total RNA extractor and then removed the

possible DNA contamination with gDNA eraser.

The RNA was examined in 1.0% (w/v) agarose gel.

The first strand cDNA was prepared by the

manufacturer’s instruction of the PrimeScript RT

reagent kit. The primers RmGPx-F1

(5’-ACGACCTCACAACGCTCAG-3’) and

RmGPx-R1

(5’-GTGGGAAAGGCGAGGATATT-3’) were used

for PCR amplification with cDNA. The PCR

product was sequenced by Sangon Biotech.

2.3 Expression of the Recombinant

Protein

According to the sequencing result of GPx gene, the

forward primer RmGPx-F2 (5'-

CGCGGATCCACCAGCGTCGCCTCTTTC -3')

contained a BamHI restriction site (underlined

nucleotides) and reverse primer RmGPx-R2 (5'-

CCCAAGCTTTGCGGACTCGGCGAGCG -3')

contained a HindIII restriction site (underlined

nucleotides) were designed to amplify the

corresponding open reading frame (ORF). After

PCR was performed, the product was purified,

digested with BamHI and HindIII and cloned into

the same restriction enzyme sites of pET28a

expression vector. The recombinant plasmid was

transformed into E. coli BL21 cells. The

transformants were selected on LB plates with 100

μg/ml kanamycin. Plasmid DNA in the positive

clones was extracted with SanPrep column plasmid

mini-preps kit and digested with BamHI and HindIII.

The cloned gene was verified by PCR reaction.

2.4 IPTG Induction Expression of GPx

Gene

For the expression of GPx gene,

isopropyl-β-D-thiogalactopyranoside (IPTG) was

added to LB medium containing 1 mM kanamycin.

For the determination of the optimum induction

time, every two hours, 5 ml culture cells were

collected and mixed with 5x protein sample buffer,

and boiled for 4 min. After a short centrifugation,

the mixtures were conducted to SDS-PAGE

electrophoresis to detect the expression of target

protein. The electrophoresis was run at 120 V with

12.5% separating gel, and stained with Coomassie

staining solution for 1 h followed by destaining in

destaining solution.

For the determination of the optimum

concentration of IPTG induction, when the

transformants grew to mid-log phase, IPTG was

added to the medium to the final concentration of

0.1, 0.2, 0.4, 0.6, 0.8 and 1.0 mM, respectively.

After incubation for 2 h, cells were collected by

centrifugation and subjected to SDS-PAGE analysis.

2.5 Purification of the Recombinant

Protein

The recombinant protein was expressed by 0.1 mM

IPTG induction for 2 h. The collected cells were

resuspended with cold 0.05 M phosphate buffer (pH

7.0) and broken by the ultrasonic technique for 10

min. After centrifugation, the precipitate was

dissolved with 8 M urea. SDS-PAGE

electrophoresis was used to detect protein

expression in the supernatant and precipitate.

The recombinant protein was purified by Ni

column affinity chromatography. The sample was

firstly washed with 5 bed volumes of washing

buffer to remove contaminating proteins, and then

the target proteins were eluted by elution buffer. The

elution was detected by A

280

value and SDS-PAGE

assay.

ICBEB 2022 - The International Conference on Biomedical Engineering and Bioinformatics

554

3 RESULTS AND ANALYSIS

3.1 Cloning of RmGPx Gene

3.1.1 RNA Extraction

The total RNA of Antarctic yeast AN5 was

extracted with the total RNA extractor kit, and

electrophoretic detection is shown in Fig. 1. It can

be seen that the extracted RNA has three obvious

bands of 28s, 18S and 5S rRNA, indicating that the

RNA is not degraded.

Figure 1: RNA analysis of Antarctic yeast AN5

3.1.2 PCR Amplification of RmGPx

The extracted RNA was reverse transcribed into

cDNA by reverse transcription kit. Using cDNA as

template, PCR amplification was performed with

primers RmGPx-F1 and RmGPx-R1, and

electrophoretic detection was shown in Fig. 2.

According to the primer design, the target fragment

was 671 bp, which was consistent with the expected

size, and sequencing results showed the PCR

product was correct sequence.

Figure 2: Gel electrophoresis analysis of target gene PCR

product M, DNA Marker; Lane 1, PCR product.

3.2 Bioinformatics Analysis of RmGPx

PCR amplification and sequencing showed that the

open reading frame of RmGPx gene was 498 bp,

encoding 165 amino acids. The gene sequence was

submitted to GenBank database with the sequence

predicted that the theoretical molecular weight was

18268.6 Da and the isoelectric point was 8.37,

belonging to cytoplasmic protein. Blastp analysis of

RmGPx protein showed that the similarity of

RmGPx was the highest with GPx sequences of

Rhodotorula sp. jg-1b (KWU44177), followed by

Rhodotorula toruloides NP11 (EMS25797) and

Rhodotorula graminis.

3.3 Construction of Plasmid

Pet-28a-RmGPx

3.3.1 PCR Amplification of RmGPx

Using the cloned RmGPx gene fragment as the

template, PCR amplification was carried out with

primers RmGPx-F2 and RmGPx-R2. The

electrophoresis results (Fig. 3) showed that the

target fragment is 498 bp, and the size is consistent

with the expected value.

Figure 3: PCR amplification of RmGPx gene.

3.3.2 Identification of Positive Clone

RmGPx gene and vector pET-28a(+) were

respectively digested by restriction enzymes BamHI

and HindIII. After purification and recovery, the

digested fragments were connected in proportion,

and then converted to DH5α competent cells.

Positive clones were screened by colony PCR, and

the results indicated that the target gene RmGPx was

inserted in the plasmid successfully (Fig. 4).

Cloning, Expression and Puriﬁcation of Glutathione Peroxidase of Antarctic Yeast Rhodotorula mucilaginosa AN5

555

M, DNA Marker DL2000; 1, 2, 4 and 5, Positive clones

Figure 4: Screening of positive clones.

3.3.3 Identification of Recombinant Plasmid

The plasmid of positive clone was extracted and

then identified by double enzyme digestion. The

results in Fig. 5 indicated that the band size of 500

bp was consistent with the expected value, which

proved that the recombinant expression plasmid was

successfully constructed.

M, DNA Marker; 1, recombinant plasmid; 2 and 3,

Enzymatic product.

Figure 5: Gel electrophoresis analysis of enzymatic

products of recombinant plasmid.

3.4 Expression of Recombinant GPx

3.4.1 Optimizing of IPTG Induction Time

E. coli BL21(DE3) transformed with

pET-28a-RmGPx was induced with 1 mM IPTG at

37 ℃. The protein electrophoresis results in Fig. 6

showed that an obvious new protein band was

appeared, which was consistent with the expected

value of 23.2 kDa. After band density detection,

protein expression of Lane 6 was the highest, which

indicated that 4 h was the optimum induction time.

M, protein Marker; Lane 1-3, IPTG induction of wild

bacteria at 0 h, 2 h and 4 h; Lane 4-8, IPTG induction of

recombinant bacteria at 0 h, 2 h, 4 h, 6 h and 8 h

Figure 6: Expression of recombinant protein induced by

IPTG at different time.

3.4.2 Optimizing of IPTG Induction

Concentration

E. coli BL21(DE3) transformed with

pET-28a-RmGPx was induced 4 h at 37 ℃ with

different IPTG concentrations of 0.1-1.0 mM,

respectively. The results shown in Fig. 7 indicated

that Lane 6 was the highest density value, which

demonstrated that 0.2 mM was the optimum

induction concentration of IPTG.

M, protein Marker; Lane 1, Wild bacteria without IPTG;

Lane 2, Recombinant bacteria without IPTG; Lane 3-8,

recombinant bacteria with IPTG induction of 0.1, 0.2, 0.4,

0.6, 0.8 and 1.0 mM

Figure 7: Expression of recombinant protein induced by

different IPTG concentration.

3.5 Purification of Recombinant GPx

The recombinant protein was added to the Ni

column, and the protein impurity was washed off

with binding buffer. Then the binding protein was

eluted with elution buffer containing 50 mM, 100

mM and 200 mM imidazole respectively. The eluted

samples were collected and concentrated, and then

detected by electrophoresis, and the results were

shown in Fig. 8. It could be seen that the elusion

ICBEB 2022 - The International Conference on Biomedical Engineering and Bioinformatics

556

buffer containing 50 mM imidazole could wash off

the protein impurity, and 100 mM imidazole could

elute GPx protein.

M, Protein marker; Lane 1, Recombinant bacteria without

IPTG induction; Lane 2, Total protein of IPTG induced

bacteria; Lane 3-5, Effluent fraction with 50, 100 and 200

mM imidazole buffer respectively

Figure 8: Purification of recombinant RmGPx.

4 CONCLUSIONS

In this study, the RmGPx gene was cloned,

expressed and purified from Rhodotorula

mucilaginosa AN5. The ORF of RmGPx was 498 bp

encoding 165 amino acids. The predicted molecular

weight was 18.3 kDa and the theoretical isoelectric

point was 8.37. The optimum expression conditions

were 0.2 mM IPTG at 37 ℃ for 4 hours. The

protein was purified by elution buffer of 100 mM

imidazole in Ni NTA column. All study results

supply the theoretical foundation for the functional

analysis and application of GPx protein.

ACKNOWLEDGEMENTS

This work was supported by Nature and Science

Foundation of Shandong [ZR2021MC180].

REFERENCES

Bathige, S.D.N.K., Umasuthan, N., Godahewa, G.I., et al.

(2015) Two variants of selenium-dependent

glutathione peroxidase from the disk abalone Haliotis

discus discus: Molecular characterization and immune

responses to bacterial and viral stresses. Fish Shellfish

Immunol., 45: 648-655.

Li, W., Huai, X., Li, P., et al. (2021) Genome-wide

characterization of glutathione peroxidase (GPX)

gene family in rapeseed (Brassica napus L.) revealed

their role in multiple abiotic stress response and

hormone signaling. Antioxidants (Basel), 10(9): 1481.

Matés, J.M. (2000) Effects of antioxidant enzymes in the

molecular control of reactive oxygen species

toxicology. Toxicology, 153: 83–104.

Mills, G.C. (1957) Hemoglobin catabolism. I. Glutathione

peroxidase, an erythrocyte enzyme which protects

hemoglobin from oxidative breakdown. J. Biol.

Chem., 229: 189–197.

Núñez-Pons, L., Avila, C., Romano, G., et al. (2018)

UV-protective compounds in marine organisms from

the Southern Ocean. Mar. Drugs, 16(9): 336.

Smirnoff N., Arnaud, D. (2018) Hydrogen peroxide

metabolism and functions in plants. New phytol.,

doi:10.1111/nph.15488

Thomas, D.N., Dieckmann, G.S. (2002) Antarctic Sea

ice--a habitat for extremophiles. Science, 295(5555):

641-644.

Zhang, L., Wu, M., Yu, D., et al. (2018) Identification of

glutathione peroxidase (GPX) gene family in

Rhodiola crenulata and gene expression analysis

under stress conditions. Int. J. Mol. Sci., 19(11):

3329.

Zhang, Y., He, Y., He, L., et al. (2015) Molecular cloning

and characterization of a phospholipid hydroperoxide

glutathione peroxidase gene from a blood fluke

Schistosoma japonicum. Mol. Biochem. Parasit., 203:

5-13.

Zhang, Y., Yang, X., Luo, Z.X., et al. (2021) Effects of

polystyrene nanoplastics (PSNPs) on the physiology

and molecular metabolism of corn (Zea mays L.)

seedlings. Sci. Total Environ., 13:150895.

Cloning, Expression and Puriﬁcation of Glutathione Peroxidase of Antarctic Yeast Rhodotorula mucilaginosa AN5

557