Expression of MicroRNA-155 and Suppressor of Cytokines Signaling

1 (SOCS1) mRNA in Plasma Breast Cancer Patients

Dwi Nur Indah Sari

, Dina Rahmina

, Sumadi Lukman

, Artanto Wahyono

Indwiani Astuti

, Sofia Mubarika

and Teguh Aryandono

Department of Biomedicine, School of Dentistry, Faculty of Medicine, Jenderal Soedirman University, Purwokerto,

Indonesia

Graduate Student Biomedical Science, Faculty of Medicine, Nursing and Public Health, Universitas Gadjah Mada,

Yogyakarta, Indonesia

Department of Surgery, Faculty of Medicine, Nursing and Public Health, Universitas Gadjah Mada, Yogyakarta,

Indonesia

Derpartment of Pharmacology and Therapy, Faculty of Medicine, Nursing and Public Health, Universitas Gadjah Mada,

Yogyakarta, Indonesia

Department of Histology and Cell Biology, Faculty of Medicine, Nursing and Public Health, Universitas Gadjah Mada,

Yogyakarta, Indonesia

Keywords: Breast cancer, plasma, microRNA-155, SOCS1 mRNA.

Abstract: Breast cancer is the most common cancer in women worldwide. miR-155 has been discovered to have an

important role in the development of breast cancer. miR-155 targets many mRNAs of tumor suppressor genes,

one of them is SOCS1. The discovery of miRNA in body fluids provides a novel alternative for the

development of minimally invasive biomarker in cancer. However, limited study has been reported on the

expression of miR-155 and SOCS1 mRNA in plasma breast cancer patients especially in Indonesian

population.This study analyzed expressions of miR-155 and SOCS1 mRNA in plasma breast cancer patients

This study was conducted using cross-sectional design, 32 plasma samples were collected from Dr.Sardjito

Hospital. RNA was extracted from plasma and then cDNA was synthesized from RNA samples. Real-time

qPCR was used to detect expression of miR-155 and mRNA SOCS1. Both expression was analyzed using

Livak's method. The significance of the results were tested statistically using independence T-test. Expression

of miR-155 at advanced stage was 2.43 higher than the early stages (p=0.047), while the mRNA expression

of SOCS1 at advanced stage was 1.29 lower than early stage (p=0.170). Expression of miR-155 in ER, PR,

& HER2 status revealed differences among subgroups, while the mRNA expression of SOCS1 was not

significantly different. Other result showed that miR-155 expression was higher in triple negative tumor, while

SOCS1 higher in luminal A tumor. Nevertheless, the difference was also not statistically significant (p value

> 0,05). This study showed that expressions of miR-155 and SOCS1 mRNA was deregulated in breast cancer

plasma and it believed to have an important role in breast cancer.



https://orcid.org/0000- 0003-4691-9840

https://orcid.org/0000- 0003-0125-8604

https://orcid.org/0000- 0002-2607-6682

https://orcid.org/0000- 0001-6870-4475

https://orcid.org/0000- 0001-7008-9192

https://orcid.org/0000- 0001-7205-652X

https://orcid.org/ 0000-0003-4998-0006

Indah Sari, D., Rahmina, D., Lukman, S., Wahyono, A., Astuti, I., Mubarika, S. and Aryandono, T.

Expression of MicroRNA-155 and Suppressor of Cytokines Signaling 1 (SOCS1) mRNA in Plasma Breast Cancer Patients.

DOI: 10.5220/0010490402230230

In Proceedings of the 1st Jenderal Soedirman International Medical Conference in conjunction with the 5th Annual Scientiﬁc Meeting (Temilnas) Consortium of Biomedical Science Indonesia

(JIMC 2020), pages 223-230

ISBN: 978-989-758-499-2

223

1 INTRODUCTION

MicroRNAs (miRNA) are short non-coding RNA

molecules that play important role as regulators of

various cellular processes in post-transcriptional

process (Ying et al. 2008). The role of miRNA is

mediated by inhibition of translation or target

mRNAs degradation. The mechanism of interaction

between miRNA and mRNA is based on sequence

complementation (Iorio & Croce 2009). Several

biological processes are modulated by miRNAs,

therefore deregulation of miRNAs expression is

associated with various disease. Deregulation of

miRNA expression has also been widely reported in

various cancers, including breast cancer (Singh & Mo

2013; Iorio & Croce 2012; Ventura & Jacks 2009;

Garzon et al. 2006).

Based on the target mRNAs, miRNA are divided

into oncogenic miRNAs (oncomirs) and tumor

suppressive miRNAs (Cho, 2011; Garzon et al.

2006). miR-155 plays as oncomir, and its

overexpression is frequently reported in a number of

malignant diseases (Higgs & Slack 2013; Johansson

et al. 2013; Zhang et al. 2013; Jiang et al. 2012; Kong

et al. 2010; Faraoni et al. 2009). Overexpression of

miR-155 is reported during early development and

progression of breast cancer. The expression of miR-

155 has been studied that it has correlation with

SOCS1 expression. It was reported that SOCS1,

tumor suppressor gene, become target of miR-155

(Zhao et al. 2013; Huang et al. 2013; Cho, 2011; Jiang

et al. 2010).

SOCS1 (Suppressor of cytokines signaling 1) is a

negative feedback pathway regulator of Janus-

activated kinase (JAK) / signal transducer and

activator of transcription signaling (STAT) (Fujimoto

& Naka 2010; Croker et al. 2009). Activation of JAK

/ STAT stimulates cells to proliferate, migrate or

undergo apoptosis (Murray 2007; Rawlings et al.

2004). In the mammary gland, JAK / STAT plays role

in the development of the mammary gland

(particularly JAK1 and JAK2). Uncontrolled

activation of JAK / STAT lead to tumorigenesis

(Santillán-Benítez et al. 2014; Wagner & Schmidt

2011). SOCS1 regulates activation of JAK / STAT in

order to maintain breast cells in homeostasis.

The initial study of the miR-155 and SOCS1 was

reported in pancreatic cancer cells by Huang et al.

(Huang et al., 2013). They reported that miR-155

played an important role in the regulation of invasion

and migration of cancer cells via modulation of

STAT3 and SOCS1 (Huang et al. 2013). The

discovery of miRNA in body fluids represents a new

alternative for the development of minimally invasive

biomarker in breast cancer in addition to the use of

Ca-153 which is not specific ( Zheng et al. 2011;

Corcoran et al. 2011; Brase et al. 2010). Previous

studies showed that the expression of miR-155 in the

serum of breast cancer patients was associated with

clinical stages, molecular types, proliferation index

and p53 expression ( Zeng et al. 2014; Zheng et al.

2012). However, no study reported the expression of

miR-155 and SOCS1 mRNA in the plasma of breast

cancer patients especially for the Indonesian

population. Expressions of miR-155 and SOCS1

mRNA from plasma of breast patients were

performed in this study.

2 MATERIALS AND METHODS

This study was designed as observational study and

cross sectional study.

2.1 Sample

Plasma samples of breast cancer patients were

obtained from Dr. Sardjito Hospital. Samples were

collected from patients that clinically and

pathologically confirmed have breast cancer, not have

another cancer, have not received any treatment, and

aged 30-70 years.

Table 1: Characterics of samples

Characteristic N %

Sta

Earl

sta

(

I-II

)

10 31,25%

Advanced stage (III-IV)

22 68,75%

Receptor

ER Positive 17 60,71%

ER Ne

ative 11 39,29%

PR Positive 13 50,00%

PR Ne

ative 13 50,00%

HER2 Positive

40,00%

HER2 Ne

ative 15 60,00%

Molecular subtype

Luminal A 10 35,71%

Luminal B 8 28,57%

HER2 overex

ression 4 14,28%

Tri

le ne

ative 6 21,42%

2.2 RNA Extraction and cDNA

Synthesis

RNA extraction was performed using RNA Isolation

Kit miRCURY-Biofluid according to the

manufacturer’ protocol. After RNA isolation, cDNAs

JIMC 2020 - 1’s t Jenderal Soedirman International Medical Conference (JIMC) in conjunction with the Annual Scientiﬁc Meeting

(Temilnas) Consortium of Biomedical Science Indonesia (KIBI )

224

were synthesised using cDNA Synthesis kit II, 8-64

rxns. Each reaction was incubated 42°C for 60

minutes, 95°C for 5 minutes and followed by

indefinite incubation at 4°C in PCR themal cycler

(Biorad c1000).

2.3 Real Time-quantitative PCR

(qPCR) of miR-155

qPCR was performed using ExiLent SYBR Green

master mix (Cat No. 203402, Exiqon) and miRCURY

LNATM Universal RT microRNA PCR for hsa-miR-

155-5p. one reaction was mixed according to the

manufacturer’s protocol. Each reaction was then

incubated with following programs : denaturation

95°C for 10 minutes, 40 cycles amplification : 95

C for 10 seconds in Biorad CFX 96. MiR-16 was

used as reference gene for miR-155-5p

quantification. Relative expression was calculated

according to the comparative Livak’s Method : 2

-∆∆Cq

If the fold change <1, value of fold decreased was

calculate by 1/fold change.

2.4 Real Time PCR mRNA SOCS1

One-Step qRT-PCR using KAPA™ SYBR® kit was

used to analyze SOCS1 mRNA expression. One

reaction was mixed according to the manufacturer’s

protocol. qPCR program were performed on Biorad

CFX 96. cDNA synthesis 45

C for 5 minutes, RT

inactivation 95°C for 3 minutes, denaturation 95° C

for 10 s, annealing for 30 seconds 59,4°C

amplification of 45 cycles : 95°C for 10 seconds and

59 , 4 °C for 30-second ramp-rate 1,6°C / s Optical

read and melting curve analysis. Beta Actin mRNA

was used as reference gene for SOCS1 mRNA

quantification. Relative expression was calculated

according to the comparative Livak’s Method : 2

-∆∆Cq

If the fold change <1, value of fold decreased was

calculate by 1/fold change.

2.5 Statistical Analysis

All of the miR-155 and SOCS1 expression

differences among breast cancer subgroup was then

analyzed statistically using Independent T-tests.

Statistical significance was determined when P value

≤ 0.05.

3 RESULT

3.1 Interaction Analysis of miR-155

with mRNA SOCS1 (in silico)

Interaction analysis of miR-155 with its target mRNA

was carried out through bioinformatic analysis on

miRanda/mirtarbase

(www.mirtarbase.mbc.nctu.edu.tw). One of the

targets for mir-155 is mRNA SOCS1. The SOCS1

mRNA sequence has a length of 1216 base pairs with

the region predicted to interact with miR-155 being in

the 3'UTR (untranslated region) of SOCS1 mRNA.

Possible interaction of miR-155 with 3'UTR mRNA

SOCS1 occur at three site, at 15-34 nucleotides withal

Minimum Free Energy (MFE) -15,50 kj/mol, at 218-

242 nucleotides withal MFE -15,90 kj/mol and at

nucleotides 404-425 withal MFE -9,13 kj/mol (see

figure 1).

Figure1. Binding site of miR-155 on 3’UTR region

mRNA SOCS1

3.2 Expression of miR-155 and mRNA

SOCS1

Expressions of miR-155 and SOCS1 mRNA were

analyzed by qRT-PCR as previously described.

Expression of miR-155 was calculated defined from

Cq value. Cq value represents first cycle in PCR when

the quantitative graph increased exponentially. The

small Cq value means concentration of PCR product

is high in the sample. Then Cq value were used to

calculated the expression of miR-155 and SOCS1

mRNA using Livak’s Method. The fold change (FC)

value could upregulated (FC>1) or downregulated

(FC<1). If the fold change <1, value of fold decreased

was calculate by 1/fold change.

Expression of miR-155 in advanced stage of

breast cancer patients was significantly higher than

TGACCGGCAGCGCCCGCCGTGCACGCAGCATTAAC

TGGGATGCCGTGTTATTTTGTTATTACTTGCCTGG

AACCATGTGGGTACCCTCCCCGGCCTGGGTTGGAG

GGAGCGGATGGGTGTAGGGGCGAGGCGCCTCCCGC

CCTCGGCTGGAGACGAGGCCGCAGACCCCTTCTCA

CCTCTTGAGGGGGTCCTCCCCCTCCTGGTGCTCCC

TCTGGGTCCCCCTGGTTGTTGTAGCAGCTTAACTG

TATCTGGAGCCAGGACCTGAACTCGCACCTCCTAC

CTCTTCATGTTTACATATACCCAGTATCTTTGCAC

AAACCAGGGGTTGGGGGAGGGTCTCTGGCTTTATT

TTTCTGCTGTGCAGAATCCTATTTTATATTTTTTA

AAGTCAGTTTAGGTAATAAACTTTATTATGAAAGT

Expression of MicroRNA-155 and Suppressor of Cytokines Signaling 1 (SOCS1) mRNA in Plasma Breast Cancer Patients

225

early stage. Expression of miR-155 in advanced stage

of breast cancer was 2.43 times higher than the early

stage. In addition, expression of SOCS1 in early stage

was higher than advanced stage. Fold change

expression of SOCS1 in advanced stage of breast

cancer was 0.77 times to early stage. It was mean

expression of SOCS1 in advanced stage of breast

cancer was 1.29 fold decreased from early stage

However, the differences were not statistically

significant (See Table 2).

Table 2: miR-155 and SOCS1 mRNA expression

according to clinical stage

Sample

Mean

(ΔCq)

∆∆Cq

Fold

change

-∆∆Cq

)

value

miR-155

Advanced stage

11.51

-1.28

2.43

(up-

regulated)

0.047

Early stage

12.79

SOCS1 mRNA

Advanced stage

4.90

0.38

0.77

(down-

regulated)

0.170

Early stage

4.53

p value were analyzed with independent t-test

We subclassified samples by their estrogen

receptor (ER), progesterone receptor (PR) and HER2

receptor. Expression of miR-155 was not

significantly different between ER + and ER -. Fold

change expression miR-155 in PR - was 0.76 times to

PR +. It was mean that expression miR-155 in PR -

was 1.31 fold decreased from PR +. Expression of

miR-155 in HER2 - was higher 2.55 times from

HER2 +. However, the different miR-155 expression

was not statistically significant (see Table 3).

The expression of SOCS1 mRNA was also

analyzed according ER, PR, and HER2 status. The

results showed that expression of SOCS1 were not

different in both in ER + and ER - and also in HER2

+ and HER2 -. But in PR - was slightly lower than in

PR +. However, that were not statistically different

between different ER, PR, and HER2 status (see

Table 4).

Subtypes of breast cancer have been implicated to

determine prognosis. We subclassified breast cancer

patients according to the subtypes. Our result showed

expression of miR-155 was higher in triple negative

than the other subtypes, while the highest expression

of SOCS1 mRNA was in Luminal A subtype and the

lowest was in triple negative subtype.

Then, we compared expression of miR-155 and

SOCS1 mRNA between Luminal A and other

subtypes. The result showed that miR-155 in Luminal

A was upregulated/higher than Luminal B dan HER2

overexpressions subtype, but lower than Triple

negative subtype. However, the differences were not

statistically significant. Our result also showed that

expression of SOCS1 mRNA in Luminal A subtype

was higher than in the other subtypes but that were

not statically significant.

Table 3. miR-155 expression according to ER, PR,

HER2

Sample

Mean

(ΔCq)

∆∆Cq

Fold change (2

∆∆Cq

)

value

ER- 11.47

-0.17 1.13 0.838

ER+ 11.64

PR- 11.84

0.39

0.76

(downregulated)

0.648

PR+ 11.45

HER2- 11.17

-1.35

2.55

(upregulated)

0.074

HER2+ 12.52

p value were analyzed with independent t-test

Table 4. SOCS1 mRNA expression according to ER, PR,

and HER2 expression

Sample Mean

(ΔCq)

∆∆Cq Fold change

-∆∆Cq

)

value

ER- 4.74

0.01 0.99 0.994

ER+

4.73

PR- 5.04

0.32

0.80

(down-

regulated)

0.482

PR+

4.72

HER2- 4.87

-0.10 1.07 0.830

HER2+ 4.97

p value were analyzed with independent t-test

Table 5 miR-155 expression in subtype

Subtype

Mean

(ΔCq)

∆∆Cq

Fold change

-∆∆Cq

)

value

Luminal A 10.94

-0.68

1.60

(up-

regulated)

0,506

Luminal B

11.62

Luminal A 10.94

-0.94

1.92

(up-

regulated)

0,547

HER2

overexpression 11.88

Luminal A 10.94

0.92

0.53

(down-

regulated)

0,461

Triple negative 10.02

p value were analyzed with independent t-test

JIMC 2020 - 1’s t Jenderal Soedirman International Medical Conference (JIMC) in conjunction with the Annual Scientiﬁc Meeting

(Temilnas) Consortium of Biomedical Science Indonesia (KIBI )

226

Table 6 SOCS1 mRNA expression in subtype

Subtype

Mean

(ΔCq)

∆∆Cq

Fold

change (2

∆∆Cq

)

P value

Luminal A 4.59

-0.27

1.21

(up-

regulated)

0,570

Luminal B

4.86

Luminal A 4.59

-0.57

1.48

(up-

regulated)

0.353

HER2 over

expression

5.16

Luminal A 4.59

-0.61

1.52

(up-

regulated)

0.380

Triple

negative

5.20

p value were analyzed with independent t-test

4 DISCUSSION

MicroRNAs (miRNA) are short non-coding RNAs

that play an important role in the regulation of gene

expression post-transcriptionally (Ying et al. 2008).

In bioinformatics analysis, miR-155 targets many

genes, one of which is SOCS1 mRNA. miR-155

interacted with SOCS1 mRNA at 3'UTR. The

strongest interaction between miR-155 and SOCS1

mRNA might be in 218-242 base of 3'UTR SOCS1

which was indicated by the most negative mfe value.

Ragan et al. (2011) reported that the mfe value

indicates the free energy used to break the structure

of the interactions that occur between miR and target

mRNA. The more negative mfe value will make it

difficult to break this structure. This means that the

structure has high stability (Chan & Zhang, 2009).

The high stability of the miR-mRNA interaction

structure allows the role of miR-155 in the regulation

of SOCS1 mRNA expression.

Our study has been performed with plasma of

breast cancer patients and the expression of

microRNA can be detected in this samples. It showed

that microRNA in plasma was relatively stable and

provides to be potential alternative for minimal

invasive cancer biomarkers (Zheng et al. 2011;

Kosaka et al. 2010). MiRNAs are relatively stable in

body fluids because miRNAs are protected in lipid

complex or lipoprotein such as apoptotic bodies,

microvesicle, or exosome (Cortez et al. 2011; Kosaka

et al. 2010) or presence in a modified structure

(methylation, adenylation, uridilasi) (Chen et al.

2012).

Our results also showed SOCS1 mRNA can be

detected in plasma samples. This might occur because

SOCS1 mRNA was also protected within

microvesicle (Kosaka et al. 2010; Marini et al. 2006).

In this study, expression of miR-155 was

significantly higher (2.43 times) at an advanced stage

than early stages of breast cancer patients (p=0,047).

Other study showed overexpression of miR-155 both

at an early stage and advanced stage breast cancer

compared with healthy controls. In the advanced

stage breast cancer, expression of miR-155 was

significantly higher compared with than early stages

(p <0.05) (Wang et al. 2012). Studies by Zheng et al.

and Liu et al showed increased expression of miR-

155 in breast cancer patients. They found that the

expression of miR-155 correlated with proliferation

index, lymph node infiltration, and advanced stage

(Zheng et al. 2012; Zeng et al. 2014).

miR-155 has been reported as regulator in the

growth stimulating factor and metastasis (Sun et al.

2012). The role of microRNA in metastasis is

suggested by the presence of microRNA within

exosome in circulation. Exosomal microRNAs plays

a role in the intercellular communication

(Schwarzenbach et al. 2014; Cortez et al. 2011).

Plasma miR-155 is thought to be uptaked by recipient

cells, causing changes in the expression of mRNA

targets of miR-155 in these cells (Cheng, 2015). The

cancer cells might be utilized miRNA to influence

their development and has been reported to have a

strong correlation with cancer invasion and

metastasis (Sun et al., 2012; Cheng et al., 2015).

One of the miR-155 targets is SOCS1 mRNA.

SOCS1 is a major regulator JAK-STAT pathway that

affects expression of various genes involved in cancer

progression (proliferation, invasion, migration,

apoptosis resistance, and angiogenesis) (Huang et al.

2013). Our study showed that expression of SOCS1

at an advanced stage was lower than in the early stage

of breast cancer. Our results were similar with a study

by Sasi et al, that SOCS1 expression decreased in the

higher-stage breast cancer and positively correlated

with the clinical outcome of patients (Sasi et al.

2010). Jiang et al. (2010) reported that in breast

cancer cell line, the decreased expression of SOCS1

was thought to be due to SOCS1 mRNA being

targeted by miR-155. Huang et al. (2013) reported

that miR-155 plays an important role in regulating the

invasion and migration of cancer cells by decreasing

SOCS1 expression, resulting in continuous STAT3

activation.

In this study, we also demonstrated that

expression of miR-155 in different of ER, PR and

HER2 status. The result was not statistically different

both ER status. miR-155 was higher in PR + than PR-

breast cancer, and was higher in HER2- than HER2 +

breast cancer. Expression of miR-155 on PR + might

be affect the growth of breast cancer. Tanos et al.

Expression of MicroRNA-155 and Suppressor of Cytokines Signaling 1 (SOCS1) mRNA in Plasma Breast Cancer Patients

227

(2012) reported that through binding to its receptor,

progesterone induces STAT3 activation in breast

cancer via the JAK and Src pathways. Absence or

reduction of negative regulator (SOCS1), resulting in

continuously active STAT3 leading to cancer

progression. However, this result is not supported by

fold change of SOCS1 mRNA. This might occur

because miR-155 targets other PR-related mRNAs.

Expression of SOCS1 in both PR+ and PR- breast

cancer was similiar in our study. This result was

different with the study conducted by Sun et al. Sun

and colleagus showed that progesterone up regulated

SOCS1 expression through induction of LPS (Sun et

al. 2012).

In this study, miR-155 expression appeared to be

higher in patients with HER2- than HER2+, whereas

SOCS1 mRNA expression was almost the same in

both HER2 states. Bischoff et al. (2015) reported that

miR-155 might be act as a negative regulator of

HER2 signaling. miR-155 was reported to decrease

HER2-induced Akt activity, but miR-155 played a

role in increasing basal Akt activity. This is in line

with reports that miR-155 is positively correlated

with basal PI3K activation by targeting PI3K negative

regulators (p85α and SHIP) (Huang et al., 2013), and

upstream negative regulator PI3K (SOCS1) (Jiang et

al., 2010).

In subtype breast cancer, our result showed that

expression of miR-155 was elevated in Triple-

negative breast cancer. However, the result showed

not statistically significant. This result was same as

result of a study by Blenkiron et al. (2007) that

documented elevated miR-155 expression in the

triple negative breast cancer. Lu et al (2012) also

reported that expression of miR-155 in plasma also

showed significant differences among the subtypes of

breast cancer with the highest expression was seen in

triple negative subtype followed by HER2

overexpression, Luminal B, and Luminal A (p =

0.027).

In Triple negative breast cancer, expression of ER,

PR, and HER2 is negative. A microRNA profiling

study by Gasparini et al. (2014) showed that there

were 4 miRNAs that were correlated with triple

negative subtypes, one of them was miR-155. The

high expression of miR-155 in triple negative subtype

might be associated with BRCA1 (Chang & Sharan

2012). BRCA1 is a gene that is frequently mutated in

breast cancer, especially in the triple negative subtype

(Bange et al. 2001). Davis et al reported that silencing

of BRCA1 leads to reduced expression of ER and PR

(Davis et al , 2014).

SOCS1 expression was higher in luminal A. The

luminal subtype is the subtype with the best

prognosis. This is in accordance with Sasi et al.

(2010) who reported that the expression of SOCS1

was positively correlated with good outcomes (the

lowest recurrence and the lowest mortality rate). (Sasi

et al. 2010).

5 CONCLUSIONS

In plasma of breast cancer patients, expression of

miR-155 in advanced stage was higher than in the

early stages, while the expression of SOCS1 mRNA

in advanced stage was lower than the early stage.

MiR-155 was differentially expressed according to

ER, PR, HER2 while the expression of SOCS1 was

not different according to ER, PR, HER2. miR-155

expression was higher in triple negative, while

SOCS1 was higher in luminal A. However, the

differences were not statistically significant.

Deregulation of miR-155 dan SOCS1 expressions is

believed to have important role in breast cancer

progressivity.

ACKNOWLEDGEMENTS

This study was support by a grant from the PUPT

2014 grants, Universitas Gadjah Mada. Researchers

supervisor: Prof. dr. Sofia Mubarika H., M.Med.Sc,

Ph.D and Prof. Dr. dr. Teguh Aryandono Sp.B (K)

Onk; Research Advisor: dr. Artanto Wahyono, Sp.B.,

Dr.med. dr. Indwiani Astuti; Prof. Dr. Mustafa, Apt.,

Kes; dr. Ahmad Hamim Sadewa, Ph.D., Drs. Zulaela,

Dipl. Med. Stat., M.Si. dr. Ahmad Ghozali, Sp.PA(K)

for analized immunohistochemistry data’s patients.

Laboratory supervisor : Risky Oktriani, S. Si, M.

Biotech, dr. Sumadi Lukman A., Ph.D., dr.

Zulrachman Erlangga, Nihayatus Saadah, S. Si,

M.Sc. and the entire members of the study group

mikroRNA (genomiR).

REFERENCES

Bange, J., Zwick, E. & Ullrich, A., 2001. Molecular targets

for breast cancer therapy and prevention. Nat Med,

7(5), 548–52.

Berishaj, M., Gao, S. P., Ahmed, S., et al., 2007. Stat3 is

tyrosine-phosphorylated through the interleukin-6 /

glycoprotein 130 / Janus kinase pathway in breast

cancer. Breast Cancer Res, 9(3), 1–8.

Bischoff, A., Bayerlova, M., Strotbek, M., Schmid, S.,

Beissbarth, T., & Olayioye, M. O. 2015. A global

microRNA screen identities regulators of the ErbB

JIMC 2020 - 1’s t Jenderal Soedirman International Medical Conference (JIMC) in conjunction with the Annual Scientiﬁc Meeting

(Temilnas) Consortium of Biomedical Science Indonesia (KIBI )

228

receptor signaling network. Cell Comm Sig. 13 (5): 1-

15.

Blenkiron, C., Goldstein, L. D., Thorne, N. P., et al., 2007.

MicroRNA expression profiling of human breast

cancer identifies new markers of tumor subtype.

Genome Biol, 8(10), 214.1–.16.

Brase, J.C., Wuttig, D., Kuner, R., et al., 2010. Serum

microRNAs as non-invasive biomarkers for cancer.

Mol Cancer, 9(1), 1–9.

Chan, H. S., & Zhang, Z. 2009. Liaison amid disorder: non-

native interactions may underpin long-range coupling

in proteins. Journal of Biology. 8(3): 27.

Chang, S. & Sharan, S.K., 2012. BRCA1 and microRNAs:

emerging networks and potential therapeutic targets.

Mol. Cells, 34(5), 425–32.

Chen, X., Liang, H., Zhang, J., et al., 2012. Secreted

microRNAs: a new form of intercellular

communication. Trends in cell biology, 22(3), 125–32.

Cheng, G. 2015. Circulating miRNAs: roles in cancer

diagnosis, prognosis and therapy. Advanced Drug

Delivery Reviews. 81: 75–93.

Corcoran, C., Friel, A. M., Duffy, M. J., et al., 2011.

Intracellular and extracellular microRNAs in breast

cancer. Clin Chem, 57(1), 18–32.

Cortez, M.A., Bueso-ramos, C., Ferdin, J., et al., 2011.

MicroRNAs in body fluids—the mix of hormones and

biomarkers. Nat Rev Clin Oncol, 8(8), 467–77.

Croker, B.A., Kiu, H. & Nicholson, S.E., 2009. SOCS

regulation of the JAK/STAT signaling pathway. Semin

Cell Dev Biol, 19(4), 414–22.

Faraoni, I. Antonetti, F. R., Cardone, J., et al., 2009. MiR-

155 gene: a typical multifunctional microRNA.

Biochim Biophys Acta, 1792(6), 497–505.

Fujimoto, M. & Naka, T., 2010. SOCS1 , a negative

regulator of cytokine signals and TLR responses , in

human liver diseases. Gastroenterol Res Pract, 2010,

1–7.

Garzon, R. Marcucci, G., & Croce, C. M. 2006. MicroRNA

expression and function in cancer. J Mol Med, 12(12),

580–7.

Gasparini, P., Cascione, L., Fassan, M., & Lovat, F. 2014.

MicroRNA expression profiling identifies a four

microRNA signature as a novel diagnostic and

prognostic biomarker in triple negative breast cancers.

Oncotarget. 5(5): 1174–84.

Gupta, N. & Mayer, D., 2013. Interaction of JAK with

steroid receptor function. JAK-STAT, 2, 37–41.

Higgs, G. & Slack, F., 2013. The multiple roles of

microRNA-155 in oncogenesis. J Clin Bioinformatics,

3, 1–8.

Huang, C. Li, H., Wu, W., et al., 2013. Regulation of miR-

155 affects pancreatic cancer cell invasiveness and

migration by modulating the STAT3 signaling

pathway through SOCS1. Oncol Rep, 30, 1223–30.

Iorio, M. V & Croce, C.M., 2012. MicroRNA dysregulation

in cancer : diagnostics , monitoring and therapeutics .

A comprehensive review. EMBO Mol Med, 4, 143–59.

Iorio, M. V & Croce, C.M., 2009. MicroRNAs in cancer:

small molecules with a huge impact. J Clin Oncol,

27(34), 5848–56.

Jiang, S. et al., 2012. A novel miR-155/miR-143 cascade

controls glycolysis by regulating hexokinase 2 in

breast cancer cells. EMBO J, 31(8), 1985–98.

Jiang, S., Zhang, H. & Lu, M., 2010. MicroRNA-155

functions as an oncomiR in breast cancer by targeting

the Suppressor of Cytokine Signaling 1 gene. Cancer

Res, 70, 3119–27.

Johansson, J. et al., 2013. MiR-155-mediated loss of

C/EBPβ shifts the TGF-β response from growth

inhibition to epithelial-mesenchymal transition,

invasion and metastasis in breast cancer. Oncogene,

32(50), 5614–24.

Kong, W. He, L., Coppola, M., et al., 2010. MicroRNA-155

regulates cell survival, growth, and chemosensitivity

by targeting FOXO3a in breast cancer. The Journal of

biological chemistry, 285(23), 17869–79.

Kosaka, N., Iguchi, H. & Ochiya, T., 2010. Circulating

microRNA in body fluid: a new potential biomarker

for cancer diagnosis and prognosis. Cancer Sci,

101(10), 2087–92.

Liu, J. Mao, Q., Liu, Y., et al., 2013. Analysis of miR-205

and miR-155 expression in the blood of breast cancer

patients. Chin J Cancer Res, 25(1), 46–54.

Lu, Z. Ye, Y., Jiao, D., et al., 2012. MiR-155 and miR-31

are differentially expressed in breast cancer patients

and are correlated with the estrogen receptor and

progesterone receptor status. Oncology Letters, 4(5),

1027–32.

Marini, A. et al., 2006. Epigenetic Inactivation of Tumor

Suppressor Genes in Serum of Patients with

Cutaneous Melanoma. J Invest Dermathol, 126, 422–

431.

Martin, E.C. Rhodes, L. Elliot, S., et al., 2014. microRNA

regulation of mammalian target of rapamycin

expression and activity controls estrogen receptor

function and RAD001 sensitivity. Mol Cancer, 13(1),

1–13.

Murray, P.J., 2007. The JAK-STAT signaling pathway:

input and output integration. J Immunol, 178,.2623–

29.

Ragan, C., Zuker, M., Ragan, M.A. 2011. Quantitative

prediction of miRNA-mRNA interaction based on

equilibrium concentrations. PLoS Compt Biol. 7 (2):

e10001090.

Rawlings, J.S., Kristin, M. & Harrison, D.A., 2004. The

JAK / STAT signaling pathway. J Cell Sci, 1(117),

1281–83.

Santillán-Benítez, J.G. Mendieta-Zeró, H., Gómez-Oliván,

L. M., et al., 2014. JAK2, STAT3 and SOCS3 gene

expression in women with and without breast cancer.

Gene, 547(1), 70–6.

Sasi, W. Jiang, W. G., Sharma, A., et al., 2010. Higher

expression levels of SOCS 1 , 3 , 4 , 7 are associated

with earlier tumour stage and better clinical outcome

in human breast cancer. BMC Cancer, 10(178), 1–13.

Sasi, W. Sharma, A. K., Mokbel, K., et al., 2014. The role

of Suppressors of Cytokine Signalling in human

neoplasms. Mol Biol Int, 2014, 1–24.

Expression of MicroRNA-155 and Suppressor of Cytokines Signaling 1 (SOCS1) mRNA in Plasma Breast Cancer Patients

229

Schwarzenbach, H., Nishida, N., Calin, G. A., et al., 2014.

Clinical relevance of circulating cell-free microRNAs

in cancer. Nat Rev Clin Oncol, 1–12.

Singh, R. & Mo, Y.-Y., 2013. Role of microRNAs in breast

cancer. Cancer Biol Ther, 14(3), 201–12.

Sun, Y. Wang, M., Lin, G., et al., 2012. Serum microRNA-

155 as a potential biomarker to track disease in breast

cancer. PloS One, 7(10), 1–8.

Tanos, T., Rojo, L. J., Echeverria, P., & Brisken, C. 2012.

ER and PR signaling nodes during mammary gland

development. Breast Can Res. 14:210

Ventura, A. & Jacks, T., 2009. MicroRNAs and cancer:

short RNAs go a long way. Cell, 136(4), 586–91.

Wagner, K.-U. & Schmidt, J.W., 2011. The two faces of

Janus kinases and their respective STATs in mammary

gland development and cancer. (published online)

Wang, H. Tan, G., Dong, L., et al., 2012. Circulating miR-

125b as a marker predicting chemoresistance in breast

cancer. PloS one, 7(4), 1–8.

Ying, S.-Y., Chang, D.C. & Lin, S.-L., 2008. The

microRNA (miRNA): overview of the RNA genes that

modulate gene function. Mol Biotechnol, 38(3), 257–

68.

Zeng, H. Fang, C., Nam, S., et al., 2014. The

clinicopathological significance of microRNA-155 in

breast cancer: a meta-analysis. BioMed research

international, 2014, 724209.

Zhang, C.-M., Zhao, J. & Deng, H.-Y., 2013. MiR-155

promotes proliferation of human breast cancer MCF-7

cells through targeting tumor protein 53-induced

nuclear protein 1. J Biomed Sci, 20, 1–10.

Zhao, X. Zhang, W., Liang, H., et al., 2013. Overexpression

of miR -155 Promotes Proliferation and Invasion of

Human Laryngeal Squamous Cell Carcinoma via

Targeting SOCS1 and STAT3. PloS one, 8(2), 1–11.

Zheng, D. et al., 2011. Plasma microRNAs as novel

biomarkers for early detection of lung cancer. Int J

Clin Exp Pathol, 4(6), 575–86.

Zheng, S.-R. Guo, G.-L., Zhang, W., et al., 2012. Clinical

significance of miR-155 expression in breast cancer

and effects of miR-155 ASO on cell viability and

apoptosis. Oncology reports, 27(4), 1149–55..



JIMC 2020 - 1’s t Jenderal Soedirman International Medical Conference (JIMC) in conjunction with the Annual Scientiﬁc Meeting

(Temilnas) Consortium of Biomedical Science Indonesia (KIBI )

230