Chitosan Nanoparticle as a Delivery System of miRNA 217 for

Suppressing Hepatocellular Carcinoma Progressivity by Targeting

AEG-1/P53

Ulfatun Nisa

, Indwiani Astuti

, Ronny Martien

, Dhani Rinaldi Maulana

, Ysrafil

Medicinal Plant and Traditional Medicine Research and Development Center, Ministry of Health, Tawangmangu,

Indonesia

Departement of Pharmacology and Therapy, Faculty of Medicine, Public Health and Nursing, Universitas Gadjah Mada,

Yogyakarta, Indonesia

Department of Pharmaceutics, Faculty of Pharmacy, Universitas Gadjah Mada, Yogyakarta, Indonesia

Department of Biotechnology, The Graduate School, Universitas Gadjah Mada, Yogyakarta, Indonesia

Department of Pharmacy, Health Polytechnic of Gorontalo, Gorontalo, Indonesia

Keyword: Chitosan, Nanoparticle, miRNA-217, AEG-1, Hepatocellular carcinoma

Abstract: MicroRNA, especially miRNA-217, has important role in development of Hepatocellular Carcinoma (HCC)

through its relation with astrocyte elevated gene 1 (AEG-1) who modulates several signaling arrays. Delivery

systems could be crucial factors for successful gene therapy. We investigated effects of chitosan nanoparticles

as delivery system of miRNA-217 for targeting AEG-1 in HCC. Chitosan nanoparticles were prepared using

ionic gelation methods. Entrapment efficiency was obtained using a NanoDrop spectrophotometer. Mimic

miRNA-217 encapsulated by chitosan nanoparticles were transfected in HCC cell line HepG2. Viability test

was conducted by using MTT Assay. The dosages of miRNA-217 were ¼, ½ and 1 IC50. A real-time

polymerase chain reaction determined miRNA-217 and mRNA relative expressions. Independent T-tests were

used to analyze the parameter differences. Results showed that chitosan nanoparticles could encapsulate miR-

217 with 92.9% entrapment efficiency. miR-217 was successfully delivered and significantly increase the

endogenous expression of miRNA-217 in HepG2 cells compared to controls. It mediated significant cell

inhibition in chitosan nanoparticles group compared to naked miRNA. The expression of mRNA AEG-1 was

decreased significantly compared to controls. The increased expression of miRNA-217 was negatively

correlated to AEG expression. Chitosan nanoparticles of miRNA-217 may suppress cell line progressivity via

targeting AEG-1.

1 INTRODUCTION

Hepatocellular carcinoma causes the third-highest

cancer-related mortalities with the least survival years

worldwide (Jariwala et al., 2015). The life expectancy

is less than six months from diagnosis (Torre et al.,

2015; Xie et al., 2017; Jia et al., 2018). Furthermore,

most patients with HCC are diagnosed late because of

the asymptomatic course of the disease. The

therapeutic effects of several treatments of HCC are



https://orcid.org/0000-0001-8743-3121

https://orcid.org/0000-0001-7008-9192

https://orcid.org/0000-0001-7291-6497

https://orcid.org/0000-0002-6080-2174

https://orcid.org/0000-0002-5980-7525

still limited. Since the underlying mechanisms of the

formation of HCC are still elusive, novel therapeutic

strategies are needed for this aggressive malignant

tumor (Jia et al., 2018).

MicroRNA (miRNA) is known to have an

important role in the regulation of gene expression.

Lu et al. revealed that all cancers have different

miRNA expression profiles than normal tissues (Lu

et al., 2005; Santos-carballal, 2018). Downregulated

miRNAs serve as a tumor suppressor miRNA

Nisa, U., Astuti, I., Martien, R., Maulana, D. and Ysraﬁl, .

Chitosan Nanoparticle as a Delivery System of miRNA 217 for Suppressing Hepatocellular Carcinoma Progressivity by Targeting AEG-1/P53.

DOI: 10.5220/0010489001310138

In Proceedings of the 1st Jenderal Soedirman International Medical Conference in conjunction with the 5th Annual Scientiﬁc Meeting (Temilnas) Consortium of Biomedical Science Indonesia

(JIMC 2020), pages 131-138

ISBN: 978-989-758-499-2

131

regarding HCC development and progression (Jia et

al., 2018). One of the tumor suppressor miRNAs is

mir-217, which is downregulated in patients with

HCC (Jariwala et al., 2015).

The research reported several oncogenic

pathways are regulated by astrocyte elevated gene 1

(AEG-1). These are Akt, nuclear factor-κβ (NF-κB),

Wnt/β-catenin, and mitogen-activated protein kinase

(MAPK) pathways. Additionally, the upregulation of

AEG-1 expression can promote cell proliferation and

anchorage-unrestrained growth ability in HCC (Meng

et al., 2012; Shi and Wang, 2015). Other previous

studies showed overexpression of mRNA and protein

AEG-1 levels in most patients with HCC, associated

with cancer progression and aggressive metastatic

stage (Yoo et al., 2009; Sarkar, 2013; Robertson et

al., 2014).

Recently, mRNA delivery systems were explored

to verify the most appropriate method to transfect

mRNA into target cells. However, nanoparticles are

the preferred method because of their potential

advantages (Phua et al., 2013). Nanoparticles can

protect the mRNA, which is susceptible to nuclease

degradation and facilitate uptake leading to targeted

genes (Phua et al., 2013; Glackin et al., 2018).

Cationic-based nanoparticles can interact with a

negatively charged nucleic acid to form

nanocomplexes. One of the polycations of

nanoparticles is chitosan. This polymer has been

widely studied due to its biodegradability and low

toxicity (Esquivel et al., 2015). Several methods can

be applied to prepare chitosan-based nanoparticles,

and the simplest one is ionotropic gelation (Gennari

et al., 2019). This method's key lies in the strong

electrostatic interaction between polymers and

crosslinker agents (Esquivel et al., 2015;

Prasetyo et

al., 2019).

As previously known, viral vectors and

lipofectamine play a pivotal role in drug delivery for

gene therapeutics. In contrast, viral vectors'

disadvantages include significant safety issues and

immunogenic responses (Santos-carballal, 2018; Guo

and Huang, 2012). In terms of cytotoxicity,

lipofectamine has serious toxicity in cell viability

(Mukerjee et al., 2011). Herein, we report the

development of a novel miRNA-217 based chitosan

nanoparticles preparation, which can be employed for

drug delivery (Lee et al., 2011; Khan et al., 2019). To

elucidate the intracellular processing of miRNA 217,

we investigated chitosan nanoparticles' effect

delivery system of miRNA-217 for targeting AEG-1

in HCC.

2 MATERIALS AND METHODS

2.1 Materials

Molecular medium-weight chitosans were obtained

from Sigma Aldrich (St. Louis, MO). Sodium

tripolyphosphate was purchased at LPPT Universitas

Gadjah Mada. The human carcinoma cell line HepG2

was obtained from BPPT (Jakarta, Indonesia). It was

maintained in high glucose DMEM supplemented

with 10% fetal bovine serum (Massachusetts, USA),

1% penicillin-streptomycin (Massachusetts, USA),

and 0.5% amphotericin (Massachusetts, USA) at

C with 5% CO

. miRNeasy Mini Kit, miRCURY

LNA

RT kit, SYBR green PCR kit and

SensiFASTTM SYBR

were purchased from Qiagen

(USA).

2.2 Chitosan-Nanoparticle based

miRNA-217 Formulation

The chitosan medium molecular weight was

dissolved into 1% acetic acid. The solution was

vigorously stirred using a magnetic stirrer for 4

hours. The pH of the solution had been adjusted to

5.5 while NaOH 1 M was added. The solution 1%

chitosan was added with acetate buffer ph 5 to

generate 0.2% chitosan solution. Preparation of

chitosan nanoparticles was done with ionic gelation

methods. It was obtained by mixing 0.2% chitosan

and sodium tripolyphosphate (5:1) and incubating for

5 minutes at room temperature. Then, 150 μL mimic

miR-217 was conjugated into 150 μL of chitosan

nanoparticle solution and then incubated for 20

minutes at room temperature (Ysrafil et al., 2020).

2.3 Entrapment Efficiency

miR-217, which was formulated by chitosan

nanoparticles, were centrifuged for 15 minutes at a

speed of 13.000 g. The absorbance of supernatants

was measured by using NANO-Quant.

Determination of efficient entrapment was calculated

using the following equation:

𝐸𝐸% 

𝐸𝑛𝑐𝑎𝑝𝑠𝑢𝑙𝑎𝑡𝑒𝑑 𝑚𝑖𝑅𝑁𝐴  𝑓𝑟𝑒𝑒 𝑚𝑖𝑅𝑁𝐴

𝐸𝑛𝑐𝑎𝑝𝑠𝑢𝑙𝑎𝑡𝑒𝑑 𝑚𝑖𝑅𝑁𝐴

𝑥100%

(1)

2.4 Determination of Cell Viability

MTT assay method was used to test HepG2 Line cells'

cytotoxic activity as much as 6 x 10

HepG2 cell lines

were planted on a 96-well plate and incubated at

JIMC 2020 - 1’s t Jenderal Soedirman International Medical Conference (JIMC) in conjunction with the Annual Scientiﬁc Meeting

(Temilnas) Consortium of Biomedical Science Indonesia (KIBI )

132

C, 5% CO

for 24 hours. Then, the media was

discharged from the plate and cleaned using PBS. As

much as 100 μL/well of prepared chitosan

nanoparticles mixed with serum DMEM free media

were put into each well and incubated at 37

C and 5%

for 24 hours. The following day, each well was

discharged and filled with 100 μL MTT 0.5 mg/ml

and then incubated for 4 hours at 37

C and 5% CO

100 μL SDS 10% were added to stop the reaction,

dissolve formazan crystals, and then incubated

overnight. Each well's absorbance was determined by

using a Micro Plate Reader (Bio-Rad Model 680 XR)

(Ysrafil et al., 2020).

2.5 Cell Transfection and mRNA

Expression Assay

Cells (5x10

per well) were plated in 6-well plates

and incubated at 37

C and 5% CO

for 24 hours.

After removing the media, each well plate was filled

with 750 μL prepared chitosan nanoparticles (mixed

with free media serum) and incubated at 370C and

5% CO2 for 24 hours. According to the kit's

instruction manual, total RNA was isolated using the

miRNeasy Mini Kit (Qiagen). A nanodrop

determined the concentration of RNA. Then, cDNA

was synthesized using the miRCURY LNA

RT kit

(Qiagen). Quantification of miR-217 was determined

by quantitative polymerase chain reaction (PCR)

using miRCURY LNA

and SYBR green PCR kit.

The sequence of miRNA and references were:

5'UACUGCAUCAGGAACUGAUUGGA3'and

5'UAGCAGCACGUAAAUAUUGGCG'3,

respectively. Meanwhile, the quantification of AEG-

1 mRNA expression was measured by qPCR using

SensiFASTTM SYBR

. The primers for AEG-1 and

beta-actin mRNA were as follows for forward:

5’TGACTTCAACAGCGACACCCA3’; reverse:

5’CACCCTGTTGCTGTAGCCAAA-3’ and

forward: 5’GGGAATTCAAAACTGGAACGGT

GAAGG3’; and reverse: 5’GGAAGCTTATCAA

AGTCCTCGGCCACA-3, respectively. The Biorad

CFX 96 C.1000 quantitative PCR machine was used

to quantify measurements of all gene transcriptions.

The experiments were performed in triplicate.

Relative gene expressions were analyzed using the 2

ΔΔCT

methods, and the results were expressed as the

fold change.

2.6 Statistical Analysis

All measurements were presented in mean ± standard

deviation (SD). To determine the significant

difference between groups, independent t-tests were

performed in each group. Spearman/ Pearson

correlation analysis was also done to find the

relationship between miRNA-217 and AEG-1

mRNA. All data were analyzed using SPSS 22

software (IBM Corp., Chicago), and graphics were

presented by GraphPad Prism 7. Statistical

significance was set at P < 0.05.

3 RESULTS

The Entrapment efficiency NPs-Ch-miR-17 was

presented in fig.1. The absorption efficiency of NPs-

Ch-miR-17 was 92.19%. This percentage showed the

amount of miRNA 217, which is in the nanochitosan

matrix.

Figure 1: Entrapment efficiency of NPs-Ch-miR-17

3.1 Viability Cells

The cytotoxicity effect of nanoparticles mimic

miRNA 217 in the HepG2 -HCC cell line was

measured to determine viability cells test. Variety of

dosage concentrations of NPCs mimic miRNA 217

had were correlated to the presentation of cancer cell

inhibition up to IC50 value. The IC50 value of this

study was 120 nM. The result of the viability cells

assay had been shown in figure 2.

Chitosan Nanoparticle as a Delivery System of miRNA 217 for Suppressing Hepatocellular Carcinoma Progressivity by Targeting

AEG-1/P53

133

3.2 In Silico Target Prediction

Figure 3 showed the results of in silico target

prediction of miRNA 217. It showed AEG 1 had

been a target of miRNA 217 at 833-856 base with ΔG

= 20.5 kcal/mol. Based on the result, miRNA217 is a

tumor suppressor miRNA regulating oncogenic post

transcription gene AEG-1.

The independent t-test was conducted to whether

there were significant differences between the 30 nM

group (1/4 IC50), the 60 nM group (1/2 IC50), the

120 nM group (IC50) and the control group. These

findings resulted in a significant difference between

treatment groups compared to the control group with

a p-value <0.005.

Figure 3: In silico prediction of hsa-miRNA-217

recognized AEG-1 in the cytoplasm of HepG2 cells using

STARMirDB.



Figure 2: Viability assays to analyze inhibition of Proliferation of chitosan nanoparticle of mimic MiR-217 to HepG2

cell line (n=3). It is presented in mean ± SD. *P < 0.05.



(A) (B)

Figure 4: Relative of expression endogenous miRNA 217 (A) and mRNA AEG-1 (B) HepG2 cell line post treatment

nanoparticles mimic miRNA 217 in several doses which were measured by qPCR



JIMC 2020 - 1’s t Jenderal Soedirman International Medical Conference (JIMC) in conjunction with the Annual Scientiﬁc Meeting

(Temilnas) Consortium of Biomedical Science Indonesia (KIBI )

134

Meanwhile, the highest level of difference was

found in the group with a dose of 120 nM with a p-

value <0.001. To determine whether there was a

correlation between miRNA-217 expression and

AEG-1 in each treatment group, the Pearson test was

performed and obtained r and p values of -0.870 and

0.0001, respectively, which showed there was a very

strong negative correlation between relative

expressions of miRNA 217 and AEG-1 mRNA (p

<0.05).

4 DISCUSSION

Mechanism of microRNA-217 encapsulation

through the ionic interaction between negative

charge of the (-NH3+) group miRNA and positive

charge of tripolyphosphate of crosslinker. Indeed, the

concentration of chitosan affects entrapment

efficiency. The low chitosan concentration's low

viscosity might cause effectively penetrating miRNA

into the polymer matrix (Csaba et al., 2009; Ysrafil

et al., 2020). In this study concentration of chitosan

was 0.2%. Like previous research, this result showed

that drug ecapsulation efficiency prepared by the

ionic interaction method was more than 90%

(Agnihotri et al.,2004).

The mitochondrial dehydrogenase assay was

used to determine cellular metabolic activity as an

indicator of cell viability, proliferation and

cytotoxicity. Indication of mimic microRNA has

effectively entered the HepG2 cell is the percentage

of cell growth in the treated group led to initiate

cancer cell death (Ysrafil et al., 2020). Furthermore,

the expression of miRNA 217 was upregulated in the

treated group compared to controls.

The addition of a positive charge from the

cationic polymers into miRNA causes agarose cells'

oligonucleotide migration ability. As a delivery

system, chitosan nanoparticles will protect miRNA

from the degradation of nucleases in HepG2 cells.

Inside these cells, chitosan nanoparticles will interact

with lysozyme, an enzyme that can degrade chitosan

after cellular uptake occurs. The enzyme hydrolyzes

the glycoside bonds in chitosan's chemical structure,

causing the release of miRNA in the cytosol leading

to diminishing the targeted gene's expression (Freier

et al., 2005).

The study conducted by Zhang et al. in 2017 used

lipofectamine 2000 as a miRNA 217 mimic

transfection agent. The study used a dose of 100 nM

with an incubation period of 36 days resulting in

upregulation of miRNA-217 with a relative

expression of 2.6-2.7 times higher compared to

controls and downregulation of MTDH with

expression values which were relatively 0.3-0.4 times

lower compared to controls (Zhang et al., 2017)

These results are almost the same as in this study

using the chitosan nanoparticle transfection agent.

However, using a lipofectamine drug delivery system

certainly has a negative effect, namely high

cytotoxicity (Wang et al., 2018). Cytotoxicity studies

are one of the main concerns for the selection of

transfection reagents. Generally, transfection reagent

toxicity has a positive correlation with transfection

efficacy. However, both are influenced by the type of

cell (Wang et al., 2018).

One of the target genes of miRNA 217 is AEG-1.

This study follows previous research conducted by

Zhang et al. in 2016, which explains that miRNA 217

can inhibit HCC cancer cell proliferation by targeting

MTDH. The finding showed miRNA 217 could

suppress AEG-1 of mRNA and protein expression

(Zhang et al., 2017). Another study stated that mir-

30a-5p could reduce mRNA expression and MTDH

protein (Li et al., 2015).



Figure 5: Correlation test between relative expression of miRNA 217 and AEG-1 mRNA

0,000

0,200

0,400

0,600

0,800

1,000

1,200

1,400

0 102030

RelativeexpressionofmiRNA

217

RelativeexpressionofmRNAMTDH

Chitosan Nanoparticle as a Delivery System of miRNA 217 for Suppressing Hepatocellular Carcinoma Progressivity by Targeting

AEG-1/P53

135

Also, the activation of various signaling

pathways, such as PI3K/Akt, NF-κB, and Wnt/β-

catenin pathways, is regulated by AEG-1 (Yang et al.,

2018). Increased expression of AEG-1 causes

increased expression of genes that support

malignancy (He et al., 2015). Hence, it interacts with

NFκB resulting in growth, survival and invasion of

cancer cells. Simultaneously, tumor progression and

proangiogenesis through the PI3K/AKT pathway and

the Wnt/β-catenin pathway MAPK cause changes to

epithelial-mesenchymal transition for metastasis

(Dhiman et al., 2019). The NFκB pathway also

becomes active in the presence of AEG-1

phosphorylation. Increased AEG-1 expression will

activate inflammation regulated by NFκB, supporting

tumor development in HCC (Sarkar et al., 2008;

Emdad et al., 2016). Another study also states that

AEG-1 overexpression can suppress PTEN protein

expression (Li et al., 2015). Meanwhile, Wen fang li

et al. revealed that apoptosis-related protein

expression, notably PTEN and p53, had been

regulated by AEG-1 (Li et al., 2015).

These findings suggested that deletion of AEG-1

might increase p53 expression by upregulating

PTEN. As a tumor suppressor, p53 can initiate cell

death and suppress cell proliferation (Li et al., 2015;

Kruiswijk, Labuschagne and Vousden, 2015).

Another study revealed that the absence of AEG-1

induces apoptosis of hepatocytes, hinder mutated

transformation. Overexpression of AEG-1

encourages the tumorigenic process to maintain

various stress (Robertson et al., 2018). Increased

cytoplasmic AEG-1 expression acts as an RNA

binding protein that can induce chemoresistance. It is

of clinical significance to restore anti-cancer therapy's

sensitivity (Meng et al., 2012). This study strongly

suggested developing AEG-1-targeted as a promising

therapeutic strategy. Indeed it deserves further

investigation.

5 CONCLUSION

We concluded that nanoparticle chitosan could be

used as a delivery system for targeted therapy. In

addition, miRNA 217 can suppress hepatocellular

carcinoma progressivity by targeting AEG-1/p53.

ACKNOWLEDGMENT

This research was supported by the DAMAS project

of the Faculty of Medicine, Public Health and

Nursing UGM Yogyakarta. We thank the LRT,

LPPT, Biochemistry technician of Gadjah Mada

University for this research.

CONFLICT OF INTEREST

There is no conflict of interest in this research.

REFERENCES

Agnihotri, S. A., Mallikarjuna, N. N. and Aminabhavi, T.

M. (2004) 'Recent advances on chitosan-based micro-

and nanoparticles in drug delivery B', Journal of

Controlled Release, 100, pp. 5–28.

doi:10.1016/j.jconrel.2004.08.010.

Csaba, N., Köping-höggård, M. and Alonso, M. J.(2009)

'Ionically crosslinked chitosan/tripolyphosphate

nanoparticles for oligonucleotide and plasmid DNA

delivery', International Journal of Pharmaceutics, 382,

pp. 205–214. doi: 10.1016/j.ijpharm.2009.07.028.

Csaba, N., Köping-Höggård, M. and Alonso, M. J. (2009)

'Ionically crosslinked chitosan/tripolyphosphate

nanoparticles for oligonucleotide and plasmid DNA

delivery.', International journal of pharmaceutics.

Netherlands, 382(1–2), pp. 205–214. doi:

10.1016/j.ijpharm.2009.07.028.

Dhiman G, Srivastava N, Goyal M, Rakha E, Lothion-Roy

J, Mongan NP, Miftakhova RR, Khaiboullina SF,

Rizvanov AA, Baranwal M. (2019) 'Metadherin : A

Therapeutic Target in Multiple Cancers', Frontiets in

Oncology, 9, pp. 1–8. doi: 10.3389/fonc.2019.00349.

Emdad L, Das SK, Hu B, Kegelman T, Kang DC, Lee SG,

Sarkar D, Fisher PB. (2016) AEG-1 / MTDH / LYRIC :

A Promiscuous Protein Partner Critical in Cancer ,

Obesity , and CNS Diseases, Advances in Cancer

Research. doi: 10.1016/bs.acr.2016.05.002.

Esquivel R, Juárez J, Almada M, Ibarra J, and Valdez1 MA.

(2015) 'Synthesis and Characterization of New

Thiolated Chitosan Nanoparticles Obtained by Ionic

Gelation Method', International Journal of Polymer

Science, 2015, pp. 1–18. doi: 10.1155/2015/502058.

Freier T, Koh HS, Kazazian K, Shoichet MS (2005)

'Controlling cell adhesion and degradation of chitosan

films by N -acetylation', Biomaterials, 26, pp. 5872–

5878. doi: 10.1016/j.biomaterials.2005.02.033.

Gennari, A., Rios de la Rosa, J. M., Hohn, E., Pelliccia, M.,

Lallana, E., Donno, R., Tirella, A., & Tirelli, N. (2019).

The different ways to chitosan/hyaluronic acid

nanoparticles: templated vs direct complexation.

Influence of particle preparation on morphology, cell

uptake and silencing efficiency. Beilstein journal of

nanotechnology, 10, 2594–2608.

https://doi.org/10.3762/bjnano.10.250.

Glackin, C. A. (2018) Nanoparticle Delivery of TWIST

Small Interfering RNA and Anticancer Drugs : A

Therapeutic Approach for Combating Cancer. 1st edn,

JIMC 2020 - 1’s t Jenderal Soedirman International Medical Conference (JIMC) in conjunction with the Annual Scientiﬁc Meeting

(Temilnas) Consortium of Biomedical Science Indonesia (KIBI )

136

Mesoporous Silica-based Nanomaterials and

Biomedical Applications - Part B. 1st edn. Elsevier Inc.

doi: 10.1016/bs.enz.2018.08.004.

Guo, X. I. A. and Huang, L. (2012) 'Recent Advances in

Nonviral Vectors for Gene Delivery', Accounts of

Chemical Research, 45(7), pp. 971–979.

He, R., Yang, L., Lin, X., Chen, X., Lin, X., Wei, F., Liang,

X., Luo, Y., Wu, Y., Gan, T., Dang, Y., & Chen, G.

(2015). MiR-30a-5p suppresses cell growth and

enhances apoptosis of hepatocellular carcinoma cells

via targeting AEG-1. International journal of clinical

and experimental pathology, 8(12), 15632–15641.

(2015) 'MiR-30a-5p suppresses cell growth and

enhances apoptosis of hepatocellular carcinoma cells

via targeting AEG-1', International Journal Clinical

Experiment Pathology, 8(12), pp. 15632–15641.

Rajasekaran D, Srivastava J, Ebeid K, Gredler R, Akiel M,

Jariwala N, Robertson CL, Shen XN, Siddiq A, Fisher

PB, Salem AK, Sarkar D (2015) 'Combination of

Nanoparticle-Delivered siRNA for Astrocyte Elevated

Gene-1 (AEG-1) and All-trans Retinoic Acid (ATRA):

An Effective Therapeutic Strategy for Hepatocellular

Carcinoma (HCC)', Bioconjugate Chemistry. American

Chemical Society, 26(8), pp. 1651–1661. doi:

10.1021/acs.bioconjchem.5b00254.

Jia C, Tang D, Sun C, Yao L, Li F, Hu Y, Zhang X, Wu D.

(2018) 'MicroRNA ‑ 466 inhibits the aggressive

behaviors of hepatocellular carcinoma by directly

targeting metadherin', Oncology Reports, 40, pp. 3890–

3898. doi: 10.3892/or.2018.6763.

Khan, Ibrahim, Saeed, K. and Khan, Idrees (2019)

'Nanoparticles : Properties , applications and toxicities',

Arabian Journal of Chemistry. The Authors, 12(7), pp.

908–931. doi: 10.1016/j.arabjc.2017.05.011.

Kruiswijk, F., Labuschagne, C. F. and Vousden, K. H.

(2015) 'p53 in survival, death and metabolic health: a

lifeguard with a licence to kill.', Nature reviews.

Molecular cell biology. England, 16(7), pp. 393–405.

doi: 10.1038/nrm4007.

ee JE, Lee N, Kim T, Kim J, Hyeon T (2011)

'Multifunctional mesoporous silica nanocomposite

nanoparticles for theranostic applications', Accounts of

Chemical Research, 44(10), pp. 893–902. doi:

10.1021/ar2000259.

Li WF, Ou Q, Dai H, Liu CA. (2015) 'Lentiviral-Mediated

Short Hairpin RNA Knockdown of MTDH Inhibits Cell

Growth and Induces Apoptosis by Regulating the

PTEN / AKT Pathway in Hepatocellular Carcinoma',

International Journal of Molecular Sciences, 16, pp.

19419–19432. doi: 10.3390/ijms160819419.

Li WF, Dai H, Ou Q, Zuo GQ, Liu CA. (2015)

'Overexpression of microRNA-30a-5p inhibits liver

cancer cell proliferation and induces apoptosis by

targeting MTDH / PTEN / AKT pathway', Tumor

Biology. doi: 10.1007/s13277-015-4456-1.

Li, W., Zhou, J. and Xu, Y. (2015) 'Study of the in vitro

cytotoxicity testing of medical devices ( Review )',

Biomedical Reports, 3, pp. 617–620. doi:

10.3892/br.2015.481.

Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck

D, Sweet-Cordero A, Ebert BL, Mak RH, Ferrando AA,

Downing JR, Jacks T, Horvitz HR, Golub TR (2005)

'MicroRNA expression profiles classify human

cancers.', Nature. England, 435(7043), pp. 834–838.

doi: 10.1038/nature03702.

Meng, X., Zhu, D., Yang, S., Wang, X., Xiong, Z., Zhang,

Y., Brachova, P. and Leslie, Kimberly K (2012)

'Cytoplasmic Metadherin ( MTDH ) Provides Survival',

The Journal of Biological Chemistry, 287(7), pp. 4485–

4491. doi: 10.1074/jbc.C111.291518.

Mukerjee, A. et al. (2011) 'Efficient nanoparticle mediated

sustained {RNA} interference in human primary

endothelial cells', Nanotechnology. {IOP} Publishing,

22(44), p. 445101. doi: 10.1088/0957-

4484/22/44/445101.

Phua, K., Leong, K. and Nair, S. (2013) 'Transfection

Efficiency and Transgene Expression Kinetics of

mRNA Delivered in Naked and Nanoparticle Format',

Journal of controlled release : official journal of the

Controlled Release Society, 166. doi:

10.1016/j.jconrel.2012.12.029.

Prasetyo, Y. A., Abdassah, M. and Rusdiana, T. (2019)

'Preparation and Characterization of Glucosamine

Nanoparticle by Ionic Gelation Method Using Chitosan

and Alginate', Indonesian Journal of Pharmaceuics,

1(1), pp. 1–10.

Robertson CL, Srivastava J, Siddiq A, Gredler R, Emdad L,

Rajasekaran D, Akiel M, Shen XN, Guo C, Giashuddin

S, Wang XY, Ghosh S, Subler MA, Windle JJ, Fisher

PB, Sarkar D. (2014) 'Genetic Deletion of AEG-1

Prevents Hepatocarcinogenesis', Molecular and

Cellular Pathobiology, 74(21), pp. 6184–6194.

Robertson CL, Mendoza RG, Jariwala N, Dozmorov M,

Mukhopadhyay ND, Subler MA, Windle JJ, Lai Z,

Fisher PB, Ghosh S, Sarkar D (2018) 'Astrocyte

elevated gene-1 regulates macrophage activation in

hepatocellular carcinogenesis', Cancer Research,

78(22), pp. 6436–6446. doi: 10.1158/0008-5472.CAN-

18-0659.

Santos-carballal, B. (2018) 'Chitosan in Non-Viral Gene

Delivery : Role of Structure , Characterization Methods

, and Insights in Cancer and Rare Diseases Therapies',

Polymers, 10(444), pp. 1–51. doi:

10.3390/polym10040444.

Sarkar D, Park ES, Emdad L, Lee SG, Su ZZ, Fisher PB.

(2008) 'Molecular basis of nuclear factor-κB activation

by astrocyte elevated gene-1', Cancer Research, 68(5),

pp. 1478–1484. doi: 10.1158/0008-5472.CAN-07-

6164.

Sarkar, D. (2013) 'AEG-1/MTDH/LYRIC in Liver Cancer

Devanand', Advanced Cancer Research. 1st edn.

Elsevier Inc., 120, pp. 1–21. doi: 10.1016/B978-0-12-

401676-7.00007-3.

Shi, X. and Wang, X. (2015) 'The role of MTDH / AEG-1

in the progression of cancer', International Journal

Clinical Experiment Medicine, 8(4), pp. 4795–4807.

orre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J,

Jemal A (2015) 'Global cancer statistics, 2012.', CA: a

Chitosan Nanoparticle as a Delivery System of miRNA 217 for Suppressing Hepatocellular Carcinoma Progressivity by Targeting

AEG-1/P53

137

cancer journal for clinicians. United States, 65(2), pp.

87–108. doi: 10.3322/caac.21262.

Wang T, Larcher LM, Ma L, Veedu RN (2018) 'Systematic

Screening of Commonly Used Commercial

Transfection Reagents towards Efficient Transfection',

Molecules, 23(2564), pp. 1–15. doi:

10.3390/molecules23102564.

Xie G, Liang Ou H, Wang J, Wang G, Wang YF (2017)

'Investigation of expression level of MTDH ,

CEACAM1 and HBx in HBV- associated

hepatocarcinoma tissues and its clinical significance .',

Biomedical Research, 28(18), pp. 8038–8043.

Yang L, Tian Y, Leong WS, Song H, Yang W, Meiqi

Wang, Wang X, Kong J, Shan B, Song Z (2018)

'Efficient and tumor-specific knockdown of MTDH

gene attenuates paclitaxel resistance of breast cancer

cells both in vivo and in vitro', Breast Cancer Research.

Breast Cancer Research, 20(113), pp. 1–13.

Yoo BK, Emdad L, Su ZZ, Villanueva A, Chiang DY,

Mukhopadhyay ND, Mills AS, Waxman S, Fisher RA,

Llovet JM, Fisher PB, Sarkar D (2009) 'Astrocyte

elevated gene-1 regulates hepatocellular carcinoma

development and progression Find the latest version :

Astrocyte elevated gene-1 regulates hepatocellular

carcinoma development and progression', The Journal

of Clinical Investigation, 119(3), pp. 465–477. doi:

10.1172/JCI36460.the.

Ysrafil Y, Astuti I, Anwar SL, Martien R, Sumadi FAN,

Wardhana T, Haryana SM (2020) 'MicroRNA-155-5p

Diminishes in Vitro Ovarian Cancer Cell Viability by

Targeting HIF1α Expression', Advanced

Pharmaceutical Bulletin, 10(4), pp. 630–637. doi:

10.15171/jcvtr.2015.24.

Zhang M, Li M, Li N, Zhang Z, Liu N, Han X, Liu Q, Liao

C (2017) 'miR-217 suppresses proliferation , migration

, and invasion promoting apoptosis via targeting

MTDH in hepatocellular carcinoma', Oncology

Reports, 37, pp. 1772–1778. doi:

10.3892/or.2017.5401.

JIMC 2020 - 1’s t Jenderal Soedirman International Medical Conference (JIMC) in conjunction with the Annual Scientiﬁc Meeting

(Temilnas) Consortium of Biomedical Science Indonesia (KIBI )

138