Expression of HSA-MIR-155-5P and mRNA Suppressor of Cytokine

Signalling 1 (SOCS1) on Plasma at Early-stage and Late-stage of

Nasopharyngeal Carcinoma

Recita Indraswary

, Sofia Mubarika Haryana

Agus Surono

Department of Molecular Medicine and Oral Biology, Faculty of Dentistry, Universitas Islam Sultan Agung, Semarang,

Indonesia

Post-Doctoral Program, Faculty of Medicine, Universitas Gadjah Mada, Yogyakarta, Indonesia

Department of Ear, Nose, Throat, Faculty of Medicine, Universitas Gadjah Mada, Yogyakarta, Indonesia

Keywords: Plasma, Nasopharyngeal carcinoma, Hsa-miR-155-5p, mRNA SOCS1

Abstract: Nasopharyngeal carcinoma (NPC) is a head and neck tumor with high prevalence and recurrence rate in Asia.

Accurate therapy based on carcinoma pathogenesis at molecular level is urgently needed. Overexpression of

hsa-miR-155-5p has been identified in various carcinomas include NPC. In previous in-silico research, hsa-

miR-155-5p are known to target mRNA SOCS1, as a transduction signal suppressor for gene transcription

activator.



This study aimed to analyze different expressions of hsa-miR-155-5p and mRNA SOCS1 on plasma

patients at an early and late stage of nasopharynx carcinoma. Hsa-miR-155-5p and mRNA SOCS1 were

isolated from blood sample plasma using miRCURY RNA Isolation Kit-Biofluid. cDNA synthesized using

cDNA Synthesis kit II, 8-64 rxns running by PCR thermal cycler (Bio-Rad c1000), and Real-time qPCR (Bio-

Rad CFX 96) for Hsa-miR-155-5p. mRNA SOCS1 was analyzed by One-Step qRT-PCR using KAPA™

SYBR® kit. Hsa-miR-155-5p expressions change was upregulated 1.13-fold (p value=0.713) on the late-stage

compared to the early stage, while for mRNA SOCS1 downregulated 1.1-fold (p value=0.891) on late-stage

compared with early stage. Hsa-mir-155-5p was overexpressed on late-stage nasopharynx carcinoma and

aligned with mRNA SOCS1 downregulated expression, compared to early stage. Deregulation of -miR-155-

5p dan mRNA SOCS1 may play important role in NPC progressivity.

1 INTRODUCTION

Nasopharyngeal carcinoma (NPC) is a head and neck

tumor with a high prevalence and recurrence in Asia,

commonly in men (Wah et al., 2014; Wildeman et al.,

2013). A better understanding of the molecular basis

of tumorigenesis does improve clinical outcomes and

useful to develop early detection, for more accurate

prognosis, and developing cancer individualized

therapy (Kong et al., 2012). miRNAs offer great

potential as biomarkers for cancer detection because

of their remarkable stability in blood and their

characteristic expression in different diseases

MicroRNAs (miRNAs) are a family of small

non-coding RNA molecules with 20–23 nucleotides

https://orcid.org/0000-0003-1871-5333

https://orcid.org/0000-0001-7205-625X

https://orcid.org/0000-0003-3363-4563

in length. It has function to negatively regulate

protein-coding genes at the post-transcriptional level

by mRNA uncapping and deadenylation. This process

will lead to increased mRNA turnover and decreased

target gene expression (Abba et al., 2014; Calin &

Croce, 2006; Koturbash et al., 2011; Lu et al., 2014;

Vishwamitra et al., 2012). Deregulation of

microRNAs (miRNAs) is indicated in several

conditions such as inflammation, cancer development

and tumor progression (Calin & Croce, 2006; Y.

Huang et al., 2013; X. Liu et al., 2009; Sotiropoulou

et al., 2009; Tang et al., 2012; H. Zheng et al., 2013;

S.-R. Zheng et al., 2012).

Hsa-miR-155-5p is prominent in cancer biology.

Among microRNAs that have been linked to cancer,

it is the most commonly overexpressed in human

Indraswary, R., Haryana, S. and Surono, A.

Expression of HSA-MIR-155-5P and mRNA Suppressor of Cytokine Signalling 1 (SOCS1) on Plasma at Early-stage and Late-stage of Nasopharyngeal Carcinoma.

DOI: 10.5220/0010488000750080

In Proceedings of the 1st Jenderal Soedirman International Medical Conference in conjunction with the 5th Annual Scientiﬁc Meeting (Temilnas) Consortium of Biomedical Science Indonesia

(JIMC 2020), pages 75-80

ISBN: 978-989-758-499-2

malignancies (Du et al., 2011; Jiang, Zhang, Lu, He,

Li, Gu, et al., 2010; Palma et al., 2014; Zhang et al.,

2013). Those miRNAs that lead to tumorigenesis and

cancer are classified as oncomiRs. These oncomiRs

are not only therapeutic targets but also important

biomarkers for cancer detection and management (Du

et al., 2011).

Cytokines activate multiple intracellular

signaling pathways to produce their physiological

effects. One of the most studied pathways is involving

the receptor-associated janus kinases (JAKs) and the

latent cytoplasmic transcription factors signal

transducers and activators of transcription (STATs).

Suppressors of Cytokine Signalling1 (SOCS1) is a

negative regulator for STAT3. Activation of STAT3

will induce transcription of several genes which has a

role in oncogeneses such as cell proliferation,

differentiation, invasion, and angiogenesis (Y. Huang

et al., 2013; Jiang, Zhang, Lu, He, Li, Gu, et al.,

2010). Studies have proved that hsa-miR-155-5p

target mRNA SOCS1(L. Liu et al., 2013). Even

ribonuclease was found in human plasma and

miRNAs have proven stable in blood plasma covering

by lipid complex or lipoproteins like an apoptotic

body, micro vesicle, or exosomes (Du, 2012; Kim et

al., 2012; H. Zheng et al., 2013). This makes miRNAs

has exciting prospect as powerful and minimal-

invasive cancer biomarkers using plasma sample.

Deregulation expressions of Hsa-miR-155-5p and

mRNA SOCS1 can monitor disease progression and

treatments. This research aimed to analyze difference

expressions of hsa-miR-155-5p and mRNA SOCS1

on plasma at early and late stage of NPC.

2 MATERIALS AND METHODS

First, the insilico study was done by bioinformatic

analysis through non-profit database of microRNA-

based on notation sequences, such as miRbase,

miRTarbase, Diana miR-Path and microRNAMap.

The result shows that mRNA SOCS1 is one of hsa-

miR-155-5p with mRNAs targets. Hsa-miR-155-5p

binding site complementary occurs in along 401

nucleotides 3' untranslated region (UTR), at 15-34

nucleotides withal Minimum Free Energy (MFE) -

15,50 kj/mol, or 218-242 nucleotides withal MFE -

15,90 kj/mol, and also possible binding at nucleotides

404-425 withal MFE -9,13 kj/mol (figure1).

This initial study included 37 nasopharyngeal

carcinoma patients of early stage and late stage (Table

1). samples were obtained from Venous blood. Hsa-

miR-155-5p and mRNA SOCS1 were isolated from

blood sample plasma using miRCURY RNA

Isolation Kit-Biofluid. cDNA was synthesized using

cDNA Synthesis kit II, 8-64 rxns running by PCR

thermal cycler (Bio-Rad c1000), and Real-time qPCR

(Bio-Rad CFX 96) for Hsa-miR-155-5p. mRNA

SOCS1 was analyzed by One-Step qRT-PCR using

KAPA™ SYBR® kit. The Ct value for each product

was determined. MiR-16 was used as a reference gene

for has-miR-155-5p quantification, and mRNA Beta

Actin was used as a reference for mRNA SOCS1.

Relative quantification for transcript accumulation

was performed according to the comparative Livak

Method: 2

-∆∆Cq

Figure 1: hsa-miR-155-5p several binding site on 3’UTR

region mRNA SOCS1.

Table 1: Characteristics of samples.

Characteristics n

(

)

Sta

Earl

(

)

Late 31 (84)

Sex

Men 27 (73)

Women 10 (27)

Age

20-30 5

(

13.5

)

31-40 10

(

)

41-50 11

(

)

51-60 6 (16)

61-71 5 (13.5)

3 RESULTS

Quantitative real-time PCR was performed to

evaluate hsa-miR-155-5p and mRNA SOCS1

expressions in 37 NPC patients. From qRT-PCR

examination, the amplification of hsa-miR-155-5p

using hsa-miR-16 as a reference gene on samples

were occurring (figure 2a). No shift in peak melt

curve was validating product specificity (figure 2b).

Specific results mRNA SOCS1 obtained using

the kit KAPA ™ SYBR® One-Step qRT-PCR (figure

3), where the optimal primer concentration at 10 pmol

with annealing temperature 59.4

Hsa-miR-155-5p and mRNA SOC1 expressions

data quantifying were anlyzed statistically to

determine whether the data were normally

TGACCGGCAGCGCCC

CCGTGCACGCAGCATTAACTGGGATGCCGTGTTATTTT

GTTATTACTTGCCTGGAACCATGTGGGTACCCTCCCCGGCCTGGGTTGGAGGGA

GCGGATGGGTGTAGGGGCGAGGCGCCTCCCGCCCTCGGCTGGAGACGAGGCCGC

AGACCCCTTCTCACCTCTTGAGGGGGTCCTCCCCCTCCTGGTGCTCCCTCTGGG

TCCCCCTGGTTGTTGTAGCAGCTTAACTGTATCTGGAGCCAGGACCTGAACTCG

CACCTCCTACCTCTTCATGTTTACATATACCCAGTATCTTTGCACAAACCAGGG

GTTGGGGGAGGGTCTCTGGCTTTATTTTTCTGCTGTGCAGAATCCTATTTTATA

TTTTTAAAGTCAGTTTAGGTAATAAACTTTATTATGAAAGTTTTTTTTTT

JIMC 2020 - 1’s t Jenderal Soedirman International Medical Conference (JIMC) in conjunction with the Annual Scientiﬁc Meeting

(Temilnas) Consortium of Biomedical Science Indonesia (KIBI )

distributed. Shapiro-Wilk test results indicate that the

data quantifying of expression of hsa-miR-155-5p

and mRNA SOCS1 both early-stage and late-stage

normally distributed, Furthermore, the value of ΔΔCq

hsa-miR-155-5p with hsa-miR-16 (table 2) and

mRNA SOCS1 with Beta-actin mRNA (Table 3)

analyzed used Livak method; Fold change = 2

-∆∆Cq

Figure 2: (a) hsa-miR-155-5p and miR-16 amplification

curves on plasma NPC, analyzed by Bio-Rad CFX

ManagerTM Software. (b) hsa-miR-155-5p and hsa-miR-

16 melt peak.

Figure 3: (a) mRNA SOCS1 and mRNA Beta-actin

amplification curves done with one-step qRT-PCR using

KAPA ™ SYBR® One-Step qRT-PCR kit. (b) mRNA

SOCS1 and mRNA. Beta-actin Melt peak.

Figure 4. (a) Hsa-miR-155-5p expressions increased 1.13-

fold. (b) mRNA SOCS1 expressions decreased 1.1-fold.

Plasma samples of early-stage NPC compared with late-

stage NPC (c) mRNA SOCS1 electrophoresis result on

Agarose gel. L = Ladder (100bp), 1-3 = SOCS1 NPC early

stage, 4-6 = SOCS1 NPC late-stage, 7 = negative control.

A and B = β-actin early-stage NPC, C dan D = β-actin late-

stage NPC.

Bio-Rad CFX Manager™ Software was used to

analyzed qRT-PCR result. The results showed that

hsa-miR-155-5p expressions fold change was

upregulated 1.13 on the late-stage compared with

early-stage (figure 4a). For mRNA SOCS1, it was

downregulated 1.1-fold on late stage compared with

early stage (figure 4b). qRT-PCR results were

subsequently confirmed by electrophoresis. This was

done using 2% Agarose gel electrophoresis, running

by 100 volts for 30 minutes to determine the

specificity and consistency of SOCS1 results of qRT-

PCR (figure 4c).

4 DISCUSSION

This study was aimed to analyze different expressions

of hsa-miR-155-5p and mRNA SOCS1 on plasma

patients at an early and late stage of NPC. Livak

method result showed that hsa-miR-155-5p were

overexpressed in late-stage NPC plasma compared

with early-stage NPC.

Overexpression’s of hsa-miR-155-5p possibly

aligned with NPC progressions. Hsa-miR-155-5p is a

micro RNA that has been shown to be associated with

the progression of carcinoma in human (Li et al.,

2012; L. Liu et al., 2013).

MiR-155 overexpression is

also correlated with poor prognosis in cancer (H.

Zheng et al., 2013). It also had been proven that miR-

155 expressions in breast cancer patients serum were

associated with clinical stages (Rawlings et al., 2004).

mRNA SOCS1 expressions downregulated in

the NPC plasma late stage compared to the early-

stage. SOCS1 mRNA may be targeted by hsa-miR-

155-5p. Other studies also proved there is a negative

correlation between the expression level of miR-155

and SOCS1 (C. Huang et al., 2013). The results

showed expression of SOCS1 decreased by 1.1-fold

in the NPC plasma late stage compared to the early

stage. Downregulated of SOCS1 may increase

STAT3 expression. SOCS1 is a negative feedback

regulator on the JAK / STAT pathway and these

pathways stimulate cells to proliferate, migrate, or

apoptosis (Chen et al., 2013).

STAT3 plays an important role in carcinoma

invasion by inducing inflammatory pro-oncogenic

pathways and tumor cell immunity, including nuclear

factor-kappaB (NF-kappaB) and interleukin-6 (IL-6)

-GP130-JAK pathway. SOCS1 acts as a negative

regulator of this pathway by inhibiting STAT3

phosphorylation (Jiang, Zhang, Lu, He, Li, & Gu,

2010). The antiproliferative mechanism is carried by

SOCS1 through inhibition of JAK2 kinase activity

Expression of HSA-MIR-155-5P and mRNA Suppressor of Cytokine Signalling 1 (SOCS1) on Plasma at Early-stage and Late-stage of

Nasopharyngeal Carcinoma

Table 2. Hsa-miR-155-5p and miR-16 expressions in plasma NPC early-stage and late-stage.

NPC Plasma Targets Mean (∆Cq) ±

Deviation

∆∆Cq Fold change

-∆∆Cq

)

Early stage Hsa-miR-155-5p 10.92 ± 2.26 -0.175 1.13

Hsa-miR-16

Late sta

e Hsa-miR-155-5

10.74 ± 1.89

Hsa-miR-16

Table 3. mRNA SOCS1 and mRNA Beta-actin expressions in plasma early stage and late stage of NPC.

NPC plasma Targets Mean (∆Cq) ±

Deviation

∆∆Cq 2

-∆∆Cq

Fold change

-1/2

-∆∆Cq

Earl

sta

e mRNA SOCS1 6.24± 2.15 0.14 0.91 -1.102

mRNA BA

Late sta

e mRNA SOCS1 6.38± 2.42

mRNA BA

which prohibit the activation (phosphorylation) of

STAT3 (Yoshimura et al., 2012).

There have been many studies proving that

STAT3 is an oncogene in various malignancies. Hsa-

miR-155-5p overexpressed in Human Laryngeal

Squamous Cell Carcinoma late stage compared to

early-stage followed by downregulated of mRNA

SOCS1 expressions and overexpression of STAT3 in

late stage. Other studies have shown a decrease of

SOCS1 expressions in colonic adenocarcinoma

progression and SOCS1 was found very low

expressed on the late stage (David et al., 2014).

Until now the NPC classifications are based on

TNM (Tumor, Node, Metastasis) as defined by the

American Joint Committee on Cancer (AJCC) (Lee et

al., 2004). On the late stage, TNM has a higher value

than the early stage, reflecting the progression of

cancer cell growth exceeded from the early stage.

Hsa-miR-155-5p has an important role in tumor

progression related to its ability to modulate

epithelial-to-mesenchymal transition (EMT)

(Bouyssou et al., 2014). EMT is a cell program, where

epithelial cells transformed into mesenchymal cells

characterized by loss of polarity, adhesion loss,

motility, and increased potential ability. Cells able to

move as metastasis incidence of malignancy.

Knockdown on miR-155 resulted in the increase of

SOCS1 and STAT3 decreases in malignancy. This is

consistent with the results obtained, in which the hsa-

miR-155-5p expressions increased in the late-stage

followed by SOCS1 mRNA expression decreased.

5 CONCLUSIONS

The identification of carcinoma molecular

mechanisms is substantial to obtain successful

therapy. Plasma samples are feasible as media in NPC

molecular examinations as shown by the results

similarity in pattern with the tissues itself. Hsa-miR-

155-5p and mRNA SOCS1 were proven stable in

NPC blood plasma and able to be quantitatively

analysed. This research shows that hsa-mir-155-5p

was overexpressed on late-stage nasopharynx

carcinoma, aligned with mRNA SOCS1

downregulated expression, compared to the early

stage. Therefore, deregulation of -miR-155-5p dan

mRNA SOCS1 are believed to have a significant role

in NPC progressivity.

ACKNOWLEDGEMENTS

The authors thank the DIKTI funding research for

providing financial support of this study. The authors

thank to Universitas Gadjah Mada, Universitas Islam

Sultan Agung, Prof. Dr. dr. Teguh Aryandono Sp.B

(K) Onk, Dr. Med. dr. Indwiani Astuti, Prof. Dr.

Mustafa, Apt., Kes, dr. Ahmad Hamim Sadewa,

Ph.D., Drs. Zulaela, Dipl. Med. Stat., M.Si, Dr. dr.

Cita Herawati, Risky Oktriani, S. Si, M. Biotech, dr.

Sumadi Lukman A., Ph.D., dr. Zulrachman,

Nihayatus Saadah, S. Si, and the entire members of

the study group microRNA (genomiR) for their

support to this research.

JIMC 2020 - 1’s t Jenderal Soedirman International Medical Conference (JIMC) in conjunction with the Annual Scientiﬁc Meeting

(Temilnas) Consortium of Biomedical Science Indonesia (KIBI )

REFERENCES

Abba, M., Patil, N., & Allgayer, H. (2014). MicroRNAs in

the Regulation of MMPs and Metastasis. 625–645.

https://doi.org/10.3390/cancers6020625

Bouyssou, J. M. C., Manier, S., Huynh, D., Issa, S.,

Roccaro, A. M., & Ghobrial, I. M. (2014). Regulation

of microRNAs in cancer metastasis. Biochimica et

Biophysica Acta, 1845(2), 255–265.

https://doi.org/10.1016/j.bbcan.2014.02.002

Calin, G. a, & Croce, C. M. (2006). MicroRNA signatures

in human cancers. Nature Reviews. Cancer, 6(11), 857–

866. https://doi.org/10.1038/nrc1997

Chen, Y., Lan, Q., Zheng, T., Zhao, N., Holford, T. R.,

Lerro, C., Dai, M., Huang, H., Liang, J., Ma, S.,

Leaderer, B., Boyle, P., Chanock, S., Rothman, N., &

Zhang, Y. (2013). Polymorphisms in JAK/STAT

Signaling Pathway Genes and Risk of Non-Hodgkin

Lymphoma. Leuk Res, 37(9), 1120–1124.

https://doi.org/10.1016/j.leukres.2013.05.003.Polymor

phisms

David, M., Naudin, C., Letourneur, M., Polrot, M., Renoir,

J.-M., Lazar, V., Dessen, P., Roche, S., Bertoglio, J., &

Pierre, J. (2014). Suppressor of cytokine signaling 1

modulates invasion and metastatic potential of

colorectal cancer cells. Molecular Oncology, 8(5), 942–

955. https://doi.org/10.1016/j.molonc.2014.03.014

Du, Z. (2012). Biomarkers in Nasopharyngeal Carcinoma.

Karolinska Institutet, Stockholm, Sweden.

Du, Z., Hu, L., Wang, H., Yan, L., Zeng, Y., & Shao, J.

(2011). Upregulation of MiR-155 in Nasopharyngeal

Carcinoma is Partly Driven by LMP1 and LMP2A and

Downregulates a Negative Prognostic Marker

JMJD1A. 6(4).

https://doi.org/10.1371/journal.pone.0019137

Huang, C., Li, H., Wu, W., Jiang, T., & Qiu, Z. (2013).

Regulation of miR-155 affects pancreatic cancer cell

invasiveness and migration by modulating the STAT3

signaling pathway through SOCS1. Oncology Reports,

30(3), 1223–1230.

https://doi.org/10.3892/or.2013.2576

Huang, Y., Yang, Y. B., Zhang, X. H., Yu, X. L., Wang, Z.

Bin, & Cheng, X. C. (2013). MicroRNA-21 gene and

cancer. Med Oncol, 30(376).

https://doi.org/10.1007/s12032-012-0376-8

Jiang, S., Zhang, H.-W., Lu, M.-H., He, X.-H., Li, Y., Gu,

H., Liu, M.-F., & Wang, E.-D. (2010). MicroRNA-155

functions as an OncomiR in breast cancer by targeting

the suppressor of cytokine signaling 1 gene. Cancer

Research, 70(8), 3119–3127.

https://doi.org/10.1158/0008-5472.CAN-09-4250

Jiang, S., Zhang, H., Lu, M., He, X., Li, Y., & Gu, H.

(2010). MicroRNA-155 Functions as an OncomiR in

Breast Cancer by Targeting the Suppressor of Cytokine

Signaling 1 Gene. 6, 3119–3128.

https://doi.org/10.1158/0008-5472.CAN-09-4250

Kim, D.-J., Linnstaedt, S., Palma, J., Park, J. C., Ntrivalas,

E., Kwak-Kim, J. Y. H., Gilman-Sachs, A., Beaman,

K., Hastings, M. L., Martin, J. N., & Duelli, D. M.

(2012). Plasma components affect accuracy of

circulating cancer-related microRNA quantitation. The

Journal of Molecular Diagnostics : JMD, 14(1), 71–80.

https://doi.org/10.1016/j.jmoldx.2011.09.002

Kong, Y. W., Ferland-McCollough, D., Jackson, T. J., &

Bushell, M. (2012). microRNAs in cancer

management. The Lancet Oncology, 13(6), e249-58.

https://doi.org/10.1016/S1470-2045(12)70073-6

Koturbash, I., Zemp, F. J., Pogribny, I., & Kovalchuk, O.

(2011). Small molecules with big effects: the role of the

microRNAome in cancer and carcinogenesis. Mutation

Research, 722(2), 94–105.

https://doi.org/10.1016/j.mrgentox.2010.05.006

Lee, A. W. M., Au, J. S. K., Teo, P. M. L., Leung, T. W.,

Chua, D. T. T., Sze, W. M., Zee, B. C. Y., Oncology,

C., Hospital, Q. M., & Kong, H. (2004). Staging of

Nasopharyngeal Carcinoma : Suggestions for

Improving the Current UICC / AJCC Staging System 1.

Clin Oncol (R Coll Radiol), 269–276.

https://doi.org/10.1016/j.clon.2004.01.008

Li, S., Chen, T., Zhong, Z., Wang, Y., Li, Y., & Zhao, X.

(2012). microRNA-155 silencing inhibits proliferation

and migration and induces apoptosis by upregulating

BACH1 in renal cancer cells. Molecular Medicine

Reports, 5(4), 949–954.

https://doi.org/10.3892/mmr.2012.779

Liu, J., Mao, Q., Liu, Y., Hao, X., Zhang, S., & Zhang, J.

(2013). Analysis of miR-205 and miR-155 expression

in the blood of breast cancer patients. Chin J Cancer

Res, 25(1), 46–54. https://doi.org/10.3978/j.issn.1000-

9604.2012.11.04

Liu, L., Li, W., Wei, X., Cui, Q., Lou, W., Wang, G., Hu,

X., & Qian, C. (2013). Potent antitumor activity of

oncolytic adenovirus-mediated SOCS1 for

hepatocellular carcinoma. Gene Therapy, 20(1), 84–92.

https://doi.org/10.1038/gt.2012.4

Liu, X., Chen, Z., Yu, J., Xia, J., & Zhou, X. (2009).

MicroRNA Profiling and Head and Neck Cancer. 2009.

https://doi.org/10.1155/2009/837514

Lu, J., Xu, X., Liu, X., Peng, Y., Zhang, B., Wang, L., Luo,

H., Peng, X., Li, G., Tian, W., He, M., & Li, X. (2014).

Predictive value of miR-9 as a potential biomarker for

nasopharyngeal carcinoma metastasis. British Journal

of Cancer, 110(2), 392–398.

https://doi.org/10.1038/bjc.2013.751

Palma, C. A., Sheikha, D. Al, Lim, T. K., Bryant, A., Vu,

T. T., Jayaswal, V., & Ma, D. D. F. (2014). MicroRNA-

155 as an inducer of apoptosis and cell differentiation

in Acute Myeloid Leukaemia. 1–15.

Rawlings, J. S., Rosler, K. M., & Harrison, D. a. (2004).

The JAK/STAT signaling pathway. Journal of Cell

Science, 117(Pt 8), 1281–1283.

https://doi.org/10.1242/jcs.00963

Sotiropoulou, G., Pampalakis, G., Lianidou, E. V. I., &

Mourelatos, Z. (2009). Emerging roles of microRNAs

as molecular switches in the integrated circuit of the

cancer cell. 1443–1461.

https://doi.org/10.1261/rna.1534709.RNA

Tang, J., Ahmad, A., & Sarkar, F. H. (2012). The Role of

MicroRNAs in Breast Cancer Migration, Invasion and

Metastasis. International Journal of Molecular

Expression of HSA-MIR-155-5P and mRNA Suppressor of Cytokine Signalling 1 (SOCS1) on Plasma at Early-stage and Late-stage of

Nasopharyngeal Carcinoma

Sciences, 13(10), 13414–13437.

https://doi.org/10.3390/ijms131013414

Vishwamitra, D., Li, Y., Wilson, D., Manshouri, R., Curry,

C. V, Shi, B., Tang, X. M., Sheehan, A. M., Wistuba, I.

I., Shi, P., & Amin, H. M. (2012). MicroRNA 96 is a

post-transcriptional suppressor of anaplastic lymphoma

kinase expression. The American Journal of Pathology,

180(5), 1772–1780.

https://doi.org/10.1016/j.ajpath.2012.01.008

Wah, S., Ling, Y., Man, C., Shin, P., Ming, V., Lau, Y.,

Zhang, G., & Wai, K. (2014). Etiological factors of

nasopharyngeal carcinoma. Oral Oncology, 50(5),

330–338.

https://doi.org/10.1016/j.oraloncology.2014.02.006

Wildeman, M. a, Fles, R., Herdini, C., Indrasari, R. S.,

Vincent, A. D., Tjokronagoro, M., Stoker, S.,

Kurnianda, J., Karakullukcu, B., Taroeno-Hariadi, K.

W., Hamming-Vrieze, O., Middeldorp, J. M.,

Hariwiyanto, B., Haryana, S. M., & Tan, I. B. (2013).

Primary treatment results of Nasopharyngeal

Carcinoma (NPC) in Yogyakarta, Indonesia. PloS One,

8(5), e63706.

https://doi.org/10.1371/journal.pone.0063706

Yoshimura, A., Suzuki, M., Sakaguchi, R., Hanada, T., &

Yasukawa, H. (2012). SOCS, Inflammation, and

Autoimmunity. Frontiers in Immunology, 3(March),

20. https://doi.org/10.3389/fimmu.2012.00020

Zhang, C., Zhao, J., & Deng, H. (2013). MiR-155 promotes

proliferation of human breast cancer MCF-7 cells

through targeting tumor protein 53-induced nuclear

protein 1. Journal of Biomedical Science, 20(1), 1.

https://doi.org/10.1186/1423-0127-20-79

Zheng, H., Zhang, L., Zhao, Y., Yang, D., Song, F., Wen,

Y., & Hao, Q. (2013). Plasma miRNAs as Diagnostic

and Prognostic Biomarkers for Ovarian Cancer. 8(11).

https://doi.org/10.1371/journal.pone.0077853

Zheng, S.-R., Guo, G.-L., Zhang, W., Huang, G.-L., Hu, X.-

Q., Zhu, J., Huang, Q.-D., You, J., & Zhang, X.-H.

(2012). Clinical significance of miR-155 expression in

breast cancer and effects of miR-155 ASO on cell

viability and apoptosis. Oncology Reports, 27(4),

1149–1155. https://doi.org/10.3892/or.2012.1634

JIMC 2020 - 1’s t Jenderal Soedirman International Medical Conference (JIMC) in conjunction with the Annual Scientiﬁc Meeting

(Temilnas) Consortium of Biomedical Science Indonesia (KIBI )