Sequence Variation of Metalloprotease Genes from Three Serratia

plymuthica Isolates Collected from Rhizosphere and Pylloplant for

Sustainable Agricultural Practices

Jamsari

, Lily Syukriani

, Renfiyeni

, Husnul Rahmi

, Elly Syafriani

Agroecotechnology Department, Faculty of Agriculture, Universitas Andalas, -25136 Padang , West Sumatera, Indonesia.

Agroecotechnology Department, Faculty of Agriculture, Universitas Mahaputra, Muhammad Yamin-Solok-West Sumatera,

Indonesia.

Agrotechnology Department, Faculty of Agriculture Universitas Pembangunan Nasional Veteran, East Java-Surabaya,

Indonesia

Keywords: Metalloprotease, Serratia plymuthica, Rhizosphere, Phyloplant, Sustainable.

Abstract: The effectivity of proteolitic enzyme for biopesticide is determined mainly by the nature of biological

sources from which they have been isolated. Three isolates identified as Serratia plymuthica were isolated

from rhizsosphere of onion and phylosphere of cabbage. In order to maximize their capability as

biopesticide we isolated and characterized their metalloprotease encoding gene and looked deeper for

genetic manipulation possibility. All the three strains have similar length of 1059 bp which is shorter than

that previously expected 1107 bp. Seven point mutations along the gene sequences were observed.

However, only 780 bp could be predicted as ORF and gave 259 amino acids sequences for each strains.

Domain analysis predicted that the gene contained M48C_loiP-like motif started from 115-762 base. The

domain also contains Zn binding motif (HEXXH) indicating that their activity might be influenced by the

presence of Zn ion. The core ORF covering 250 amino acids contains three mutations events, causing amino

acid changing on Ser-35-Phe, Ser-52-Pro and Ile-208-Asn. However, three dimentional structure and ligand

binding analysis did not show any significant variation among them. The data found here, indicated that the

two strains S. plymuthica share similar proteolitic capability eventhough they isolated from two different

habitats

1 INTRODUCTION

Protease is considered to be one of the most

effective proteolytic enzymes as biofungicides

(Dunne et al., 1997). For this reason, the exploration

of proteolytic bacteria has been widely reported by

several researchers. Some species such as Bacillus

subtilis, Bacillus amyloliquefaciiens, and Bacillus

vallismortis are known to produce proteolytic

enzymes capable of inhibiting the growth of

pathogenic fungi Colletotrichum gloeosporioides,

Colletotrichum capsici, Fusarium solani, and

Septobasidium spp. (Ann, 2012). Palaniyandi et al.,

(2013) isolated Streptomyces phaeopurepureus

ExPro138 which is antagonistic to the fungus C.

coccodes, the cause of anthracnose disease in tomato

plants, while Paenibacillus polymyxa APEC128 is

known to suppress anthracnose disease in apples

caused by C. gloeosporioides and C. acutatum (Kim

et al., 2016).

Syafriani et al. (2016) identified one strain of

rhizobacteria which is capable of suppressing the

development of the phytopathogenic fungus C.

gloeosporioides, while Aisyah et al (2016)

successfully isolated two phylobacteria showing

similar actrivity. All the three strains are coded as

UBCR_12, UBCF_01 and UBCF_13. Using the 16S

rRNA gene sequence, the three species were

identified as Serratia plymuthica and their

nucleotide sequences have been deposited in NCBI

sequence databases with access codes KU299959.1,

KX394778.1 and KX394779.1 respectively.

Moreover, isolation and characterization at the

molecular level, such as isolation of genes

associated with chitinase activity have also been

performed (Syafriani, 2017) as well as their

pathogenic potency. Therefore, in the effort to

Jamsari, ., Sukraeni, L., Renﬁyeni, ., Rahmi, H. and Syafriani, E.

Sequence Variation of Metalloprotease Genes from Three Serratia plymuthica Isolates Collected from Rhizosphere and Pylloplant for Sustainable Agricultural Practices.

DOI: 10.5220/0009900500002480

In Proceedings of the International Conference on Natural Resources and Sustainable Development (ICNRSD 2018), pages 227-231

ISBN: 978-989-758-543-2

227

exploit these three isolates making as one of the

component in the sustainable agricultural practices

ie: as biopesticide or plant growth promoting agent,

further characterization of their genetic potential

becomes a high urgency.

In this article, we report the characteristics and

comparison of metalloprotease gene sequences

isolated from 3 isolate Serratia plymuthica species

collected from the rhizosphere and pyloplan regions.

2 MATERIALS AND METHODS

2.1 Bacterial Isolate Identity

One rhizsopheric and two phyllopant bacterial

isolates designated as UBCR_12; UBCF_01 and

UBCF_13 were used in this study. Collection

procedures and their morphological identity have

been previously described by (Aisyah et al., 2016;

Syafriani, 2017). Molecular identity based on their

16S rRNA gene from the isolates was also reported

by both above mentioned authors and was deposited

in the NCBI nucleotide database designated with the

accession number KU299959.1, KX394778.1 and

KX394779.1 respectively.

2.2 DNA Preparation and in-Vitro

Amplification

Genomic DNA of the three isolates was prepared as

described previously by Syafriani, et al., (2016).

Integrity of the genomic DNA was controlled with

standard electrophoresis method. Isolation of

metalloprotease gene sequences was performed by

PCR technique applying primer combination

Mtlpro-F (ATGCCAAATGAGAGCGAGTT) and

Mtlpro-R (TGGCGGAAGCGATTAACTAT).

Amplification was conducted in 25 µL of total

volume, containing 3 µL (5 ng/µL) of genomic

DNA, 15 pmol of each primer, 12, 5 µL DNA

Polymerase (KAPA2G-Japan) and 6,5 µL of ddH

Amplification was performed on T-Personal

Thermocylcer (Biometra-Germany) using PCR

condition set on 30 cycles amplification containing:

C-15 seconds of denaturation; 55

C- 30 seconds

for annealing and 72

C - 60 second. Initial

denaturation was set on 95

C for 3 minutes and

final extension was performed on 72

C for 60

seconds.

2.3 Cloning and Sequencing

PCR product showing a single unique band of 1107

bp in size was isolated from the gel and subjected

for sequencing step. Prior sequencing step, cloning

of PCR product was performed into pGem-T Easy

Vector (Promega-USA) using E. coli strain DH5α as

host by means of the heatshock technique. Positive

recombinant clones were verified directly using

T7/SP6. The positive recombinants clones from each

transformation were subjected for plasmide DNA

isolation. Sequencing was undertaken at the

sequencing service company (1st-BASE-Singapore)

from both termini using T7 and SP6 primers.

2.4 Sequence Analysis and

Bioinformatics

Nucleotide sequences data generated from the

sequencing step was verified using Bioedit software

(Hall, 1999) in order to fix their status. The editing

steps was also aimed to fix the length of complete

sequence of metalloprotease gene started from start

codon to terminator codon which was verified by

ORF finder tool available at NCBI website. The

final edited sequence data was then subjected to the

homology search by means of BLASTn (Basic

Local Alignment Search Tool) (Altschul et al.,

1990) provided at NCBI database in order to verify

their sequence homology status with other

metaloproteinase gene sequences available

worldwide. Conserved Domain analysis (Marchler-

Bauer et al., 2015) was also run to map the position

of every domain which is possibly harboring along

the sequences. Three dimentional structure was also

constructed in order to predict their tertiary structure

based on their deduced amino acid sequences. This

analysis was performed by using Pyre2 software

(Kelley et al., 2015). Finally the sequences was

compared among the three isolated sequences and

also with some metaloprotease sequence in both

nucleotide level as well as in amino acid level using

Mega6 software (Tamura et al., 2013).

3 RESULTS AND DISCUSSION

3.1 Gene Amplification and Cloning

In-vitro amplification of Metalloprotease gene

sequence using primer combination Mtlpro-F and

Mtlpro-R from the three strain UBCR_12,

UBCF_01 and UBCF_13 successfully produced

ICNRSD 2018 - International Conference on Natural Resources and Sustainable Development

228

fragment of 1.107 bp in size. However, the

fragments are not specific. Some additional faint

fragments of 700-800 bp in size are still visible

(Figure.1a). For that reason, cloning of PCR product

into pGem-T Easy Vector was undertaken.

Figure. 1: PCR product of metalloprotease gene generated

with Mtlpro-F/R primer combination obviously produced

major fragment of about 1107 bp in size (a), while

amplification of putative recombinant clones with T7/SP6

primer combination exhibited of about 1248 bp fragment

in size (b). A=UBCR-12, B=UBCF_01 and C=UBCF_13.

M = 1 kb ladder.

Selection of recombinant using Lac-Z gene

expression platform enriched with amphicillin (100

mg-/mL) succesfully differentiated non recombinant

and recombinant plasmide containing inserted target

sequence. Only one colony could be confirmed as

recombinant from each UBCR_12 and UBCF_01,

while 2 recombinant colonies were produced from

UBCF_13. Verification of all recombinant colonies

was performed using T7/SP6 primer combinations.

Representative clone from each strain produced a

major fragment of about 1248 bp in size (Figure 1b).

The additional length of fragment (about 141 bp)

generated from T7/SP6 amplification is caused by an

additional segment flanked by T7 and SP6 primers

located in the plasmid sequence. Furthermore,

amplification with T7/SP7 of putative recombinant

DNA plasmid also proved the correctness of the

recombinant clone (data not shown).

3.2 Sequence Homology Analysis

Sequence data generated from sequencing procedure

was edited and trimmed for their integrity and

finally was built as a contig from each terminusi.

Trimming the resulted contig produced a gene

sequence of 1059 bp in size from each of the three

strain. However, the gene length found in this study

is shorter than what was expected of 1107 bp, a gene

length which is commonly found in S. plymuthica.

Assuming that, a number of deletion events has

occured in our strain. In order to find out such

hypothesis we performed homology search using

BLAST tool provided at NCBI database. All the

three sequences, showed significant homology

ranging from 94,33 % to 96.00 % with

metalloprotease gene sequence available in the

NCBI database.

3.3 Distribution of Domains Along

Metaloprotease Gene Sequence

Domain motif of all three metaloprotease gene was

predicted using ORF finder software provided at:

https://www.ncbi.nlm.nih.gov/orffinder/. The

longest ORF motif from each strain showed similar

pattern. All the three strain have a 780 bp ORF

motif, encoding 259 amino acids started with ATG

and ended with TAA. Conserved Domain analysis

(CDD) (Marchler-Bauer et al., 2015) indicated that

the gene contained M48C_loiP-like motif started

from 115-762 base (Figure 2)

Figure 2: Conserved domain motif of metalloprotease

gene from three S. plymuthica strain. A= UBCR_12, B =

UBC-F_01, C = UBCF_13.

Domain motif of all three metaloprotease gene was

predicted using ORF finder software provided at:.

https://www.ncbi.nlm.nih.gov/orffinder/. The

longest ORF motif from each strain showed similar

pattern. All the three strain have a 780 bp ORF

motif, encoding 259 amino acids started with ATG

and ended with TAA. Conserved Domain analysis

(CDD) (Marchler-Bauer et al., 2015) indicated that

the gene contained M48C_loiP-like motif started

from 115-762 base (Figure 2).

Domain M48C_loiP_like belongs to the super-

family of Peptidase M48C_M56 which has close

relationship with the family Ste24 endopeptidase.

Some others members belong to this family is Ste24

protease (Peptidase M48A), protease htpX homolog

Sequence Variation of Metalloprotease Genes from Three Serratia plymuthica Isolates Collected from Rhizosphere and Pylloplant for

Sustainable Agricultural Practices

229

(peptidase M48B) atau CAAX prenly protease 1, dan

mitochondrial metallopeptidase OMA1 (peptidase

M48C). Most of them are proteins connected to the

endoplasmic reticulum and golgi apparatus complex.

The domain contains Zn binding motif (HEXXH)

and COOH-terminal ER. The HEXXH motif plays a

very important role in their catalytic and proteolytic

activity (Fujimura-Kamada et al., 1997). Mutation in

that region will omit their catalytic activity

especially for the family of protease Ste24p dan

HtpX. The peptidase M56 covers domain of Zinc-

metalloproteases of some protein MecRI and BlaRI.

That domain has significant similarity with the

catalytic activity of metallopeptidase membrane

integral M48 and M56 and belongs to the new group

of protein called minigluzincin.

3.4 Sequence Homology

In order to get the overview of homology structure

among those three metalloprotease gene, multi-

alignment analysis in nucleotide as well as in

aminoacid level was run under the Clustal Omega

(Sievers et al., 2011) tool provided at

https://www.ebi.ac.uk/Tools/msa/clustalo/. Six

substitution events were detected in the nucleotide

levels along the compared sequence of

metaloproteases gene.

Figure 3: Multiple alignment of deduced amino acid

sequences of metaloproteinase gene from three strain S.

plymuthica. Position of amino acid changes were indicated

by blue box, while red arrowhead shows position of

possible ligand binding site as analyzed by 3DligandSite

software.

The substitution events were detected at base 122,

148, 265, 315, 520, 784 and 952 (data not shown).

However based on the analysis of ORF finder, only

780 bp is the most likely might be involved in the

translational process. Therefore further analysis was

focused on that segment. Interestingly, after

translating the segment only 250 amino acids could

be produced. Multiple alignment analysis among

their amino acid sequence, exhibited three position

showing amino acid change, ie: Ser-35-Phe, Ser-52-

Pro and Ile-208-Asn.

Figure. 4: Phylogenetic tree of three metaloprotease gene

from three S. plymuthica strains among 7 other

metalloproteases.

Multiple alignment of amino acid sequences

obviously showed that UBCF_01 and UBCF_13

shared 100% homology, but they differentiated with

UBCR_12 by three amino acid. Both UBCF_01 and

UBCF_13 were collected from the phyloplant zone,

while UBCR_12 was isolated from rhizosphere zone

(Syafriani et al., 2016; Aisyah et al., 2016;

Syafriani, 2017). This comparison is also in line

with the result of cluster analysis shown in the

phylogenetic tree (Figure 4) where all the tree

sequences closely groupped in one cluster.

Figure 5. Three dimentional structure of possible metalo-

protease enzyme from rhizosphere and phyloplan. Terti-

ary structure prediction of metalopreotease enzyme from

UBCR_12 (a) and UBCF_01 (b) as predicted by Pyre2,

while c-d showing possible ligand binding site as predic-

ted by 3DligandSite software.

ICNRSD 2018 - International Conference on Natural Resources and Sustainable Development

230

Three dimentional structure prediction by Phyre2

showed no significant differentiation between

UBCR_12 and UBCF_01 (Figure 5 a-b.). Prediction

of ligand binding site from both enzymes also

indicate to aspartic acid (Asp) locating in amino acid

number 121 (Figure 5c-d)

4 CONCLUSIONS

Data obtained form this research indicated that the

two strains of S. plymuthica share similar proteolitic

capability even though they isolated from two

different habitats.

ACKNOWLEDGEMENTS

We gratefuly thank to Ministry of Research and

Higher Education of Indonesia for the financial

support via Competency Grant, contract number:

050/SP2H/LT/DRPM/2018 and 059/SP2H/LT/-

DRPM/IV/2017.

REFERENCES

Aisyah, S.N., Harnas, H., Sulastri, S., Retmi, R., Fuaddi,

H., Fatchiyah, F., Bakhtiar, A., and Jamsari, J., 2016.

Enhancement of a Novel Isolate of Serratia

plymuthica as Potential Candidate for an

Antianthracnose. Pak. J. of Biol. Sci. 19: 1-9.

Altschul, S.E., Gish, W., Miller, W., Myers, E.W., and

Lipman, D.J., 1990. Basic local alignment search tool.

J. Mol. Biol. 215: 403–410.

Ann, Y.C., 2012. Rhizobacteria of pepper (Piper nigrum)

and their antifungal activities. African J. of Microb.

Res. 6: 4185–4193.

Dunne, C., Crowley, J.J., Mo&nne-Loccoz Y., Dowling

D.N., de Bruijn F.J., and O’Gara, F.. 1997. Biological

control of Pythium ultimum by Stenotrophomonas

maltophilia W81 is mediated by an extracellular

proteolytic activity. Microbiology. 143: 3921–3931.

Fujimura-Kamada, K. Nouvet, FJ. dan Michaelis, S.

(1997). A Novel Membrane-associated Metallo-

protease, Ste24p, Is Required for the First Step of NH

2 -terminal Processing of the Yeast a-Factor

Precursor. The J. of Cell Biol. 136: 271–285.

Hall, T.A., 1999. BioEdit: a user-friendly biological

sequence alignment editor and analysis program for

Windows 95/98/NT. Nucleic Acids Symp. Ser. 41: 95-

98.

Kelley, L.A., Mezulis, S., Yates, C.M., Wass, M.N.,

Sternberg, M.J., 2015. The Phyre2 web portal for

protein modeling, prediction and analysis. Nat Protoc.

10: 845-858. doi: 10.1038/nprot.2015.053

Kim, Y.S., Balaraju, K., dan Jeon, Y., 2016. Biological

control of apple anthracnose by Paenibacillus

polymyxa APEC128, an antagonistic rhizo-bacterium.

Plant Pathol. J., 32: 251–259.

Marchler-Bauer, A., Derbyshire, M.K., Gonzales, N.R.,

Lu, S., Chitsaz, F., Geer, L.Y., Geer, R.C., He, J.,

Gwadz, M., Hurwitz, D.I., Lanczycki, C.J., Lu, F.,

Marchler, G.H., Song, J.S., Thanki, N., Wang, Z.,

Yamashita, R.A., Zhang, D., Zheng, C., Bryant, S.H.,

2015. CDD: NCBI's conserved domain database.

Nucleic Acids Res. 43(D): 222-226.

Palaniyandi, S.A., Yang, S.H., dan Suh, J.W., 2013.

Extracellular proteases from Streptomyces

phaeopurpureus ExPro138 inhibit spore adhesion,

germination and appressorium formation in

Colletotrichum coccodes. J. of Appl. Microbiol. 115:

207–217.

Sievers, F., Wilm, A., Dineen, D., Gibson, T.J., Karplus,

K., Li, W., Lopez, R., McWilliam, H., Remmert, M.,

Söding, J., Thompson, J.D., Higgins, D.G., 2011. Fast,

scalable generation of high-quality protein multiple

sequence alignments using Clustal Omega. Mol. Sys.

Biol. 7: 539.

Syafriani, E., 2017. Identifikasi Molekuler, Kloning dan

Karakterisasi In-Silico Gen-Gen Kitinase Dari

Beberapa Isolat Rhizo- Dan Pylobacteria Bersifat

Antiantraknosa. [Dissertation]. Program Pasca Sarjana

Universitas Andalas. 129 pages.

Syafriani, E., Riwany, F., Kamelia, R., Ferita, I.,

Fatchiyah, F., and Jamsari, J., 2016. A promising

novel rhizobacteria isolate UBCR_12 as antifungal for

Colletotrichum gloeosporioides. Res. J. of Pharm.

Biol. and Chem. Sci. 7: 2202–2209.

Tamura, K., Stecher, G., Peterson, D., Filipski, A., and

Kumar, S., 2013. MEGA6: Molecular Evolu-tionary

Genetics Analysis version 6.0. Mol. Biol and Evol: 30

2725-2729.

Sequence Variation of Metalloprotease Genes from Three Serratia plymuthica Isolates Collected from Rhizosphere and Pylloplant for

Sustainable Agricultural Practices

231